Journal articles: 'Braidwood Region (N.S.W.) – History' – Grafiati (2024)

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Ages of whitebone porgy (Calamus leucosteus) (n = 559) from southeastern U. S. commercial and recreational fisheries from 1975 – 2017 were determined using sectioned otoliths. Opaque zones were annular, forming April – July (peaking in June). Ages ranged from 2 – 19 years, and the largest fish measured 513 mm TL (total length, mm). Body size relationships were: TL = 1.09 FL + 16.07 (n = 469, r2 = 0.97), FL = 0.89 TL – 6.39 (n= 469, r2 = 0.97), W = 2.8 x 10-5 TL2.91 (n = 462), and W = 6.8 x 10-5 FL2.82 (n = 417) where W is total weight (grams, g) and FL is fork length (mm). The von Bertalanffy growth equations were Lt = 365 (1 - e-0.35 (t + 1.37)) (n = 559) for all areas combined, Lt = 365 (1 - e-0.55(t + 0.00)) (n = 185) for fish from North Carolina through Cape Canaveral, Florida, and Lt = 368 (1 - e-0.25 (t + 2.51)) (n = 374) for fish from southeast Florida. Mean size-at-age was significantly different between regions for ages 4 – 9, (92% of total samples). Point estimates of natural mortality were M = 0.22 and M = 0.30 for northern- and southern-region fish, respectively, while age-specific estimates of M were 0.85 – 0.55 y-1 for ages 2– 19 for the northern region and 0.41 – 0.26 (ages 2-14) for southern region fish. This study presents updated life history parameters for whitebone porgy from the Atlantic waters off the southeastern United States.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

he s ubject o f t his w ork i s a n i ndepth analysis of the structure of the built environment as a system of organised relations. Three elementary aspects expressed in binary oppositions were distinguished: interior – exterior (formal aspect), individual – collective (social aspect), variable – permanent (dynamic aspect). These aspects reflect the diverse psychophysical needs and existential states of a human being. The reorganisation of a habitat is a change in the internal relationships of these categories in a specific region and spatial scale. A healthy environment can be defined as one that balances polar categories at each level of the analysis. Reforms and re-evaluations in the built environment can be interpreted as attempts to restore balance, as illustrated with examples from the history of architecture and urban planning. The results of the work contribute to the general theory of the built environment, essential for the proper design process in a wide spectrum of spatial scale.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

This study proposes a local paleo–landscape reconstruction of the Danube floodplain based on a stratigraphic sequence retrieved from Brateș Lake which, by its emplacement near the confluence of Danube – Prut rivers, was fully receptive to changes associated to hydrological, geomorphological or anthropogenic driven events. Due to its intermediate position within the Lower Danube valley Brateș Lake is a proxy for the evolution of Cotul Dunării area (the region of Danube valley turning from S–N to W–E direction) and provide valuable information about the timing of Danube river advancement to the Black Sea after its reconnection to World Ocean. The sediments were analysed to get the history of their deposition by means of accelerator mass spectrometry (AMS) 14C dating, grain–size parameters, organic matter and carbonate content, magnetic susceptibility together with paleo–fauna and pollen content which altogether led to the identification of main stages: i) delta front advance into Danube estuary (before 8000 BP), ii) shoreline foreshore deposits which describe shoreline position (8000–7900 yrs BP), iii) river floodplain development (7900–5300/5000 yrs BP), iv) lake formation (5300/5000 yrs BP – present).

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

The Brazilian northeastern coast suffered in 2019 the greatest acute impact of oil in the country’s history, with all states in the region being affected by extra-heavy oil. Holothuria (Halodeima) grisea is a detritivorous holoturoid, which ingests sediment to feed, and can passively ingest oil from spills existing in the sediment. To investigate the occurrence of oil in the intestinal content of H. (H.) grisea, a N of 20 individuals was collected on the Salvador coast (BA) in October 2019 between the coordinates 12°57 ‘S / 38°20’ W. Of this total, 10 individuals were found dead in the environment and 10 collected alive, for comparison purposes. Of the individuals found dead, 40% were eviscerated (without intestines) and it was not possible to carry out content analysis. Of the 6 remaining dead individuals, 67% had oil in their intestinal contents. For the 10 live sea cucumbers collected, none was eviscerated and all had a full intestine, with oil being observed in the intestinal content of 1 specimen (10%). The χ2 test confirmed with α of 0.025 the possible relationship between oil and the mortality of H. (H.) grisea, demonstrating that the acute oil spill probably was lethal for this species on the northeastern coast of Brazil. Keywords: sea cucumber, hydrocarbons, PAHs.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

RESUMENEl objetivo de este artículo es reflexionar sobre los mecanismos de financiación y de control de las instituciones religiosas por los laicos en las primeras décadas de la conquista y colonización de Hispanoamérica. Investigar sobre la inversión laica en lo sagrado supone en un primer lugar aclarar la historiografía sobre laicos, religión y dinero en las sociedades de Antiguo Régimen y su trasposición en América, planteando una mirada desde el punto de vista de las motivaciones múltiples de los actores seglares. A través del ejemplo de restituciones, donaciones y legados en losAndes, se explora el papel de los laicos españoles, y también de las poblaciones indígenas, en el establecimiento de la densa red de instituciones católicas que se construye entonces. La propuesta postula el protagonismo de actores laicos en la construcción de un espacio cristiano en los Andes peruanos en el siglo XVI y principios del XVII, donde la inversión económica permite contribuir a la transición de una sociedad de guerra y conquista a una sociedad corporativa pacificada.PALABRAS CLAVE: Hispanoamérica-Andes, religión, economía, encomienda, siglos XVI y XVII.ABSTRACTThis article aims to reflect on the mechanisms of financing and control of religious institutions by the laity in the first decades of the conquest and colonization of Spanish America. Investigating lay investment in the sacred sphere means first of all to clarifying historiography on laity, religion and money within Ancien Régime societies and their transposition to America, taking into account the multiple motivations of secular actors. The example of restitutions, donations and legacies inthe Andes enables us to explore the role of the Spanish laity and indigenous populations in the establishment of the dense network of Catholic institutions that was established during this period. The proposal postulates the role of lay actors in the construction of a Christian space in the Peruvian Andes in the sixteenth and early seventeenth centuries, when economic investment contributed to the transition from a society of war and conquest to a pacified, corporate society.KEY WORDS: Hispanic America-Andes, religion, economics, encomienda, 16th and 17th centuries. BIBLIOGRAFIAAbercrombie, T., “Tributes to Bad Conscience: Charity, Restitution, and Inheritance in Cacique and Encomendero Testaments of 16th-Century Charcas”, en Kellogg, S. y Restall, M. (eds.), Dead Giveaways, Indigenous Testaments of Colonial Mesoamerica end the Andes, Salt Lake city, University of Utah Press, 1998, pp. 249-289.Aladjidi, P., Le roi, père des pauvres: France XIIIe-XVe siècle, Rennes, Presses universitaires de Rennes, 2008.Alberro, S., Les Espagnols dans le Mexique colonial: histoire d’une acculturation, Paris, A. Colin, 1992.Alden, D., The making of an enterprise: the Society of Jesus in Portugal, its empire, and beyond 1540-1750, Stanford California, Stanford University Press, 1996.Angulo, D., “El capitán Gómez de León, vecino fundador de la ciudad de Arequipa. Probança e información de los servicios que hizo a S. M. en estos Reynos del Piru el Cap. Gomez de León, vecino que fue de cibdad de Ariquipa, fecha el año MCXXXI a pedimento de sus hijos y herederos”, Revista del archivo nacional del Perú, Tomo VI, entrega II, Julio-diciembre 1928, pp. 95-148.Atienza López, Á., Tiempos de conventos: una historia social de las fundaciones en la España moderna, Madrid, Marcial Pons Historia, 2008.Azpilcueta Navarro, M. de, Manual de penitentes, Estella, Adrián de Anvers, 1566.Baschet, J., “Un Moyen Âge mondialisé? Remarques sur les ressorts précoces de la dynamique occidentale”, en Renaud, O., Schaub, J.-F., Thireau, I. (eds.), Faire des sciences sociales, comparer, Paris, éditions de l’EHESS, 2012, pp. 23-59.Boltanski, A. y Maldavsky, A., “Laity and Procurement of Funds», en Fabre, P.-A., Rurale, F. (eds.), Claudio Acquaviva SJ (1581-1615). A Jesuit Generalship at the time of the invention of the modern Catholicism, Leyden, Brill, 2017, pp. 191-216.Borges Morán, P., El envío de misioneros a América durante la época española, Salamanca, Universidad Pontifícia, 1977.Bourdieu, P., “L’économie des biens symboliques», Raisons pratiques: sur la théorie de l’action, Paris, Seuil, [1994] 1996, pp. 177-213.Brizuela Molina, S., “¿Cómo se funda un convento? Algunas consideraciones en torno al surgimiento de la vida monástica femenina en Santa Fe de Bogotá (1578-1645)”, Anuario de historia regional y de las Fronteras, vol. 22, n. 2, 2017, pp. 165-192.Brown, P., Le prix du salut. Les chrétiens, l’argent et l’au-delà en Occident (IIIe-VIIIe siècle), Paris, Belin, 2016.Burke, P., La Renaissance européenne, Paris, Seuil, 2000.Burns, K., Hábitos coloniales: los conventos y la economía espiritual del Cuzco, Lima, Quellca, IFEA, 2008.Cabanes, B y Piketty, G., “Sortir de la guerre: jalons pour une histoire en chantier”, Histoire@Politique. Politique, culture, société, n. 3, nov.-dic. 2007.Cantú, F., “Evoluzione et significato della dottrina della restituzione in Bartolomé de Las Casas. Con il contributo di un documento inedito”, Critica Storica XII-Nuova serie, n. 2-3-4, 1975, pp. 231-319.Castelnau-L’Estoile, C. de, “Les fils soumis de la Très sainte Église, esclavages et stratégies matrimoniales à Rio de Janeiro au début du XVIIIe siècle», en Cottias, M., Mattos, H. (eds.), Esclavage et Subjectivités dans l’Atlantique luso-brésilien et français (XVIIe-XXe), [OpenEdition Press, avril 2016. Internet : <http://books.openedition.org/ http://books.openedition.org/oep/1501>. ISBN : 9782821855861]Celestino, O. y Meyers, A., Las cofradías en el Perú, Francfort, Iberoamericana, 1981.Celestino, O., “Confréries religieuses, noblesse indienne et économie agraire”, L’Homme, 1992, vol. 32, n. 122-124, pp. 99-113.Châtellier Louis, L’Europe des dévots, Paris, Flammarion, 1987.Christian, W., Religiosidad local en la España de Felipe II, Madrid, Nerea, 1991.Christin, O., Confesser sa foi. Conflits confessionnels et identités religieuses dans l’Europe moderne (XVIe-XVIIe siècles), Seyssel, Champ Vallon, 2009.Christin, O., La paix de religion: l’autonomisation de la raison politique au XVIe siècle, Paris, Seuil, 1997.Clavero, B., Antidora: Antropología católica de la economía moderna, Milan, Giuffrè, 1991.Cobo Betancourt, “Los caciques muiscas y el patrocinio de lo sagrado en el Nuevo Reino de Granada”, en A. Maldavsky y R. Di Stefano (eds.), Invertir en lo sagrado: salvación y dominación territorial en América y Europa (siglos XVI-XX), Santa Rosa, EdUNLPam, 2018, cap. 1, mobi.Colmenares, G., Haciendas de los jesuitas en el Nuevo Reino de Granada, siglo XVIII, Bogotá, Universidad Nacional de Colombia, 1969.Comaroff, J. y Comaroff, J., Of Revelation and Revolution. Vol. 1, Christianity, Colonialism, and Consciousness in South Africa, Chicago, University of Chicago Press, 1991.Costeloe, M. P., Church wealth in Mexico: a study of the “Juzgado de Capellanias” in the archbishopric of Mexico 1800-1856, London, Cambridge University Press, 1967.Croq, L. y Garrioch, D., La religion vécue. Les laïcs dans l’Europe moderne, Rennes, PUR, 2013.Cushner, N. P., Farm and Factory: The Jesuits and the development of Agrarian Capitalism in Colonial Quito, 1600-1767, Albany, State University of New York Press, 1982.Cushner, N. P., Jesuit Ranches and the Agrarian Development of Colonial Argentina, 1650-1767, Albany, State University of New York Press, 1983.Cushner, N. P., Why have we come here? The Jesuits and the First Evangelization of Native America, Oxford, Oxford University Press, 2006.De Boer, W., La conquista dell’anima, Turin, Einaudi, 2004.De Certeau M., “La beauté du mort : le concept de ‘culture populaire’», Politique aujourd’hui, décembre 1970, pp. 3-23.De Certeau, M., L’invention du quotidien. T. 1. Arts de Faire, Paris, Gallimard, 1990.De la Puente Brunke, J., Encomienda y encomenderos en el Perú. Estudio social y político de una institución, Sevilla, Diputación provincial de Sevilla, 1992.Del Río M., “Riquezas y poder: las restituciones a los indios del repartimiento de Paria”, en T. Bouysse-Cassagne (ed.), Saberes y Memorias en los Andes. In memoriam Thierry Saignes, Paris, IHEAL-IFEA, 1997, pp. 261-278.Van Deusen, N. E., Between the sacred and the worldly: the institutional and cultural practice of recogimiento in Colonial Lima, Stanford, Stanford University Press, 2001.Dictionnaire de théologie catholique, 1937, s.v. “Restitution”.Durkheim, É., Les formes élémentaires de la vie religieuse, Paris, Presses universitaires de France, 1960 [1912].Duviols, P. La lutte contre les religions autochtones dans le Pérou colonial: l’extirpation de l’idolâtrie entre 1532 et 1660, Lima, IFEA, 1971.Espinoza, Augusto, “De Guerras y de Dagas: crédito y parentesco en una familia limeña del siglo XVII”, Histórica, XXXVII.1 (2013), pp. 7-56.Estenssoro Fuchs, J.-C., Del paganismo a la santidad: la incorporación de los Indios del Perú al catolicismo, 1532-1750, Lima, IFEA, 2003.Fontaine, L., L’économie morale: pauvreté, crédit et confiance dans l’Europe préindustrielle, Paris, Gallimard, 2008.Froeschlé-Chopard, M.-H., La Religion populaire en Provence orientale au XVIIIe siècle, Paris, Beauchesne, 1980.Glave, L. M., De rosa y espinas: economía, sociedad y mentalidades andinas, siglo XVII. Lima, IEP, BCRP, 1998.Godelier, M., L’énigme du don, Paris, Fayard, 1997.Goffman, E., Encounters: two studies in the sociology of interaction, MansfieldCentre, Martino publishing, 2013.Grosse, C., “La ‘religion populaire’. L’invention d’un nouvel horizon de l’altérité religieuse à l’époque moderne», en Prescendi, F. y Volokhine, Y (eds.), Dans le laboratoire de l’historien des religions. Mélanges offerts à Philippe Borgeaud, Genève, Labor et fides, 2011, pp. 104-122.Grosse, C., “Le ‘tournant culturel’ de l’histoire ‘religieuse’ et ‘ecclésiastique’», Histoire, monde et cultures religieuses, 26 (2013), pp. 75-94.Hall, S., “Cultural studies and its Theoretical Legacy”, en Grossberg, L., Nelson, C. y Treichler, P. (eds.), Cultural Studies, New York, Routledge, 1986, pp. 277-294.Horne, J., “Démobilisations culturelles après la Grande Guerre”, 14-18, Aujourd’hui, Today, Heute, Paris, Éditions Noésis, mai 2002, pp. 45-5.Iogna-Prat, D., “Sacré’ sacré ou l’histoire d’un substantif qui a d’abord été un qualificatif”, en Souza, M. de, Peters-Custot, A. y Romanacce, F.-X., Le sacré dans tous ses états: catégories du vocabulaire religieux et sociétés, de l’Antiquité à nos jours, Saint-Étienne, Publications de l’Université de Saint-Étienne, 2012, pp. 359-367.Iogna-Prat, D., Cité de Dieu. Cité des hommes. L’Église et l’architecture de la société, Paris, Presses universitaires de France, 2016.Kalifa, D., “Les historiens français et ‘le populaire’», Hermès, 42, 2005, pp. 54-59.Knowlton, R. J., “Chaplaincies and the Mexican Reform”, The Hispanic American Historical Review, 48.3 (1968), pp. 421-443.Lamana, G., Domination without Dominance: Inca-Spanish Encounters in Early Colonial Peru, Durham, Duke University Press, 2008.Las Casas B. de, Aqui se contienen unos avisos y reglas para los que oyeren confessiones de los Españoles que son o han sido en cargo a los indios de las Indias del mas Océano (Sevilla : Sebastián Trujillo, 1552). Edición moderna en Las Casas B. de, Obras escogidas, t. V, Opusculos, cartas y memoriales, Madrid, Biblioteca de Autores Españoles, 1958, pp. 235-249.Lavenia, V., L’infamia e il perdono: tributi, pene e confessione nella teologia morale della prima età moderna, Bologne, Il Mulino, 2004.Lempérière, A., Entre Dieu et le Roi, la République: Mexico, XVIe-XIXe siècle, Paris, les Belles Lettres, 2004.Lenoble, C., L’exercice de la pauvreté: économie et religion chez les franciscains d’Avignon (XIIIe-XVe siècle), Rennes, Presses universitaires de Rennes, 2013.León Portilla, M., Visión de los vencidos: relaciones indígenas de la conquista, México, Universidad nacional autónoma, 1959.Levaggi, A., Las capellanías en la argentina: estudio histórico-jurídico, Buenos Aires, Facultad de derecho y ciencias sociales U. B. A., Instituto de investigaciones Jurídicas y sociales Ambrosio L. Gioja, 1992.Lohmann Villena, G., “La restitución por conquistadores y encomenderos: un aspecto de la incidencia lascasiana en el Perú”, Anuario de Estudios americanos 23 (1966) 21-89.Luna, P., El tránsito de la Buenamuerte por Lima. Auge y declive de una orden religiosa azucarera, siglos XVIII y XIX, Francfort, Universidad de navarra-Iberoamericana-Vervuert, 2017.Macera, P., Instrucciones para el manejo de las haciendas jesuitas del Perú (ss. XVII-XVIII), Lima, Universidad Nacional Mayor de San Marcos, 1966.Málaga Medina, A., “Los corregimientos de Arequipa. Siglo XVI”, Histórica, n. 1, 1975, pp. 47-85.Maldavsky, A., “Encomenderos, indios y religiosos en la región de Arequipa (siglo XVI): restitución y formación de un territorio cristiano y señoril”, en A. Maldavsky yR. Di Stefano (eds.), Invertir en lo sagrado: salvación y dominación territorial en América y Europa (siglos XVI-XX), Santa Rosa, EdUNLPam, 2018, cap. 3, mobi.Maldavsky, A., “Finances missionnaires et salut des laïcs. La donation de Juan Clemente de Fuentes, marchand des Andes, à la Compagnie de Jésus au milieu du XVIIe siècle”, ASSR, publicación prevista en 2020.Maldavsky, A., “Giving for the Mission: The Encomenderos and Christian Space in the Andes of the Late Sixteenth Century”, en Boer W., Maldavsky A., Marcocci G. y Pavan I. (eds.), Space and Conversion in Global Perspective, Leiden-Boston, Brill, 2014, pp. 260-284.Maldavsky, A., “Teología moral, restitución y sociedad colonial en los Andes en el siglo XVI”, Revista portuguesa de teología, en prensa, 2019.Margairaz, D., Minard, P., “Le marché dans son histoire”, Revue de synthèse, 2006/2, pp. 241-252.Martínez López-Cano, M. del P., Speckman Guerra, E., Wobeser, G. von (eds.) La Iglesia y sus bienes: de la amortización a la nacionalización, México, Universidad Nacional Autónoma de México, Instituto de Investigaciones Históricas, 2004.Mauss, M., “Essai sur le don. Forme et raison de l’échange dans les sociétés archaïques (1923-1924)”, en Mauss, M., Sociologie et anthropologie, Paris, Presses universitaire de France, 1950, pp. 145-279.Mendoza, D. de, Chronica de la Provincia de San Antonio de los Charcas, Madrid, s.-e., 1665.Mills K., Idolatry and its Enemies. Colonial andean religion and extirpation, 1640-1750, Princeton, New Jersey, Princeton University Press, 1997.Mörner, M., The Political and Economic Activities of the Jesuits in the La Plata Region: The Hapsburg Era, Stockholm, Library and Institute of Ibero-American Studies, 1953.Morales Padrón, F., Teoría y leyes de la conquista, Madrid, Ediciones Cultura Hispánica del Centro Iberoamericano de Cooperación, 1979.“Nuevos avances en el estudio de las reducciones toledanas”, Bulletin of the National Museum of Ethnology, 39(1), 2014, pp. 123-167.O’Gorman, E., Destierro de sombras: luz en el origen de la imagen y culto de Nuestra Señora de Guadalupe del Tepeyac, México, Universidad nacional autónoma de México, Instituto de Investigaciones Históricas, 1986.Pompa, C., Religião como tradução: Missionários, Tupi e Tapuia no Brasil colonial, São Paulo, ANPOCS, 2003.Prodi, P. Una historia de la justicia. De la pluralidad de fueros al dualismo moderno entre conciencia y derecho, Buenos Aires-Madrid, Katz, 2008.Ragon, P., “Entre religion métisse et christianisme baroque : les catholicités mexicaines, XVIe-XVIIIe siècles», Histoire, monde et cultures religieuses, 2008/1, n°5, pp. 15-36.Ragon, P., “Histoire et christianisation en Amérique espagnole», en Kouamé, Nathalie (éd.), Historiographies d’ailleurs: comment écrit-on l’histoire en dehors du monde occidental ?, Paris, Karthala, 2014, pp. 239-248.Ramos G., Muerte y conversión en los Andes, Lima, IFEA, IEP, 2010.Rodríguez, D., Por un lugar en el cielo. Juan Martínez Rengifo y su legado a los jesuitas, 1560-1592, Lima, Universidad Nacional Mayor de San Marcos, 2005.Romano, R., Les mécanismes de la conquête coloniale: les conquistadores, Paris, Flammarion, 1972.Saignes, T., “The Colonial Condition in the Quechua-Aymara Heartland (1570–1780)”, en Salomon, F. y Schwartz, S.(eds.), The Cambridge History of theNative Peoples of the Americas. Vol. 3, South America, Cambridge, Cambridge University Press, 1999, pp. 58–137.Saignes, T., Caciques, tribute and migration in the Southern Andes: Indian society and the 17th century colonial order (Audiencia de Charcas), Londres, Inst. of Latin American Studies, 1985.Schmitt, J.-C., “‘Religion populaire’ et culture folklorique (note critique) [A propos de Etienne Delaruelle, La piété populaire au Moyen Age, avant- propos de Ph. Wolff, introduction par R. Manselli et André Vauchez] «, Annales. Économies, Sociétés, Civilisations, 31/5, 1976, pp. 941953.Schwaller, J. F., Origins of Church Wealth in Mexico. Ecclesiastical Revenues and Church Finances, 1523-1600, Albuquerque, University of New Mexico press, 1985.Spalding, K., Huarochirí, an Andean society under Inca and Spanish rule, Stanford, Stanford University Press, 1984.Stern, S. J., Los pueblos indígenas del Perú y el desafío de la conquista española: Huamanga hasta 1640, Madrid, Alianza, 1986.Taylor, W. B., Magistrates of the Sacred: Priests and Parishioners in Eighteenth-Century Mexico. Stanford University Press, 1996.Thomas, Y., “La valeur des choses. Le droit romain hors la religion”, Annales, Histoire, Sciences Sociales, 2002/T, 57 année, pp. 1431-1462.Thornton, J. K., Africa and Africans in the Formation of the Atlantic World, 1400–1680), New York, Cambridge University Press, 1998.Tibesar, A., Franciscan beginnings in colonial Peru, Washington, Academy of American Franciscan History, 1953.Tibesar A., “Instructions for the Confessors of Conquistadores Issued by the Archbishop of Lima in 1560”, The Americas 3, n. 4 (Apr. 1947), pp. 514-534.Todeschini, G., Richesse franciscaine: de la pauvreté volontaire à la société de marché, Lagrasse, Verdier, 2008.Toneatto, V., “La richesse des Franciscains. Autour du débat sur les rapports entre économie et religion au Moyen Âge”, Médiévales. Langues, Textes, Histoire 60, n. 60 (30 juin 2011), pp. 187202.Toneatto, V., Les banquiers du Seigneur: évêques et moines face à la richesse, IVe-début IXe siècle, Rennes, Presses universitaires de Rennes, 2012.Toquica Clavijo, M. C., A falta de oro: linaje, crédito y salvación, Bogotá, Universidad Nacional de Colombia, Ministero de Cultura, Instituto Colombiano de Antropología e Historia, 2008.Torre, A., “‘Faire communauté’. Confréries et localité dans une vallée du Piémont (XVIIe -XVIIIe siècle)”, Annales. Histoire, Sciences Sociales 2007/1 (año 62), pp. 101-135.Torre, A., “Politics Cloaked in Worship: State, Church and Local Power in Piedmont 1570-1770”, Past and Present, 134, 1992, pp. 42-92.Vargas Ugarte, R., “Archivo de la beneficencia del Cuzco”, Revista del Archivo Histórico del Cuzco, no. 4 (1953), pp. 105-106.Vauchez A., Les laïcs au Moyen Age. Pratiques et expériences religieuses, Paris, Cerf, 1987.Vincent, C., “Laïcs (Moyen Âge)”, en Levillain, P. (ed.), Dictionnaire historique de la papauté, Paris, Fayard, 2003, pp. 993-995.Vincent, C., Les confréries médiévales dans le royaume de France: XIIIe-XVe siècle, Paris, A. Michel, 1994.Valle Pavón, G. del, Finanzas piadosas y redes de negocios. Los mercaderes de la ciudad de México ante la crisis de Nueva España, 1804-1808, México, Instituto Mora, Historia económica, 2012.Vovelle, M., Piété baroque et déchristianisation en Provence au XVIIIe siècle, Paris, Plon, 1972.Wachtel, N., La Vision des vaincus: les Indiens du Pérou devant la Conquête espagnole, Paris, Gallimard, 1971.Wilde, G., Religión y poder en las misiones de guaraníes, Buenos Aires, Ed. Sb, 2009.Wobeser, G. von, El crédito eclesiástico en la Nueva España, siglo XVIII, México, Universidad Nacional Autónoma de México, Instituto de Investigaciones Históricas, 1994.Wobeser, G. von, Vida eterna y preocupaciones terrenales. Las capellanías de misas en la Nueva España, 1600-1821, Mexico, Universidad Nacional Autónoma de México, 2005.Zavala, S., La encomienda indiana, Madrid, Junta para ampliación de estudios e investigaciones científicas-Centro de estudios históricos, 1935.Zemon Davis, N., Essai sur le don dans la France du XVIe siècle, Paris, Seuil, 2003.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

The results of long-term studies of the vegetation of chalk outcrops of the Orenburg region (Russian Federation) and North-West Kazakhstan on Sub-Ural plateau and adjacent territories are presented. Chalk outcrops are unique botanical-geographical sites located in steppe and desert zones of Eurasia. Specific communities of calcephyte plant species have spread in these areas, in places of outcrops or close occurrence from the surface of upper-Cretaceous carbonate rocks. The flora of chalk outcrops is characterized by a great amount of rare species, mainly ende­mic, associated with peculiar substrates, the locality of habitats, and the historical past of the area of outcrops location (Matyshenko, 1985) The history of the study of flora and vegetation of chalk outcrops is given. Synthaxonomic studies of chalk vegetation as part of the ecological-floristic approach cover only territories west of the Volga river (Poluyanov, 2009; Averinova, 2011, 2016; Demina, 2014; Demina et al., 2016; Didukh et al., 2018). Chalk highlands of the North-West Kazakhstan and adjacent regions of the Russian Federation occupy quite large areas. However, up to date, there is no data on the vegetation diversity of these territories based on complete geobotanical relevés, that is why their synthaxonomy remains undeveloped. The study area with 15 massifs of chalk outcrops (Fig. 1) includes the Orenburg region (Novosergievsky, Perevolotsky, Sol-Iletskiy, Akbulak and Gaysky districts), and Aktobe (Hobdinsky, Uilsky and Bayganinsky district) and Atyrau (Zhylyoysky district) regions of the Republic of Kazakhstan. The largest massifs in the Orenburg region of the Russian Federation are: Starobelogorskie (Fig. 2), Chesnokov­skie (Fig. 3), Verkhnechibendinskie (Fig. 6), Troits­kie (Fig. 7), Pokrovskie Chalk Mountains (Fig. 4) and Durtel mountain (Fig. 5). Chalk massif Akshatau (Fig. 8) and the range Aktolagai (Fig. 9) are the largest within Aktobe region. The investigated sites are mostly located on the Sub-Ural Plateau, which extended from the southern regions of the Orenburg region to the Emba River in the territory of Aktobe region. They are less common within the Obschiy Syrt and sporadic in the Guberlinskie mountains. The study area covers a wide range of zonal vegetation from dry steppes in the northern part of the gradient to northern deserts in the southern one. The dataset includes 270 relevés of chalk outcrops communities performed by the authors in 2014–2019. The primary classification was carried out using TWINSPAN algorithm. As a result three groups of communities are established. The first group is communities of the Emben Plateau, the most southern area; second is communities on relatively developed soils in the slopes bases, depressions between chalk ridges and on their flat tops; third is widespread communities on most of the Podural Plateau and Obschy Syrt, excluding the Emben Plateau. Comparison with associations of calcephyte, semidesert and steppe vegetation (Golub, 1994; Kolomiychuk, Vynokurov, 2016; Lysenko, Yamalov, 2017; Didukh et al., 2018; Korolyuk, 2017) was made to determine the position of studied communities in the system of ecological-floristic classification of the herbasceous vegetation of Eurasia. Cluster analysis results (Fig. 10) revealed the significant specificity the chalk outcrops of the Sub-Ural Plateau in comparison with calciphytic communities of Eastern Europe, as well as with deserts and steppes zonal vegetation. That was the reason to describe a new class for vegetation of the studied chalk outcrops. The class Anabasietea cretaceae Golovanov class nov. hoc loco. Diagnostic species: Anabasis cretacea, Anthemis trotzkiana, Artemisia salsoloides, Atraphaxis decipiens,Crambe aspera, Echinops meyeri, Jurinea kirghisorum, Hedysarum tscherkassovae, Lepidium meyeri, Limonium cretaceum, Linaria cretacea, Matthiola fragrans, Nanophyton erinaceum, Seseli glabratum, Zygophyllum pinnatum;holotypus is order Anabasie­talia cretaceae ord. nov. hoc loco. Class combines calciphytic, mainly semi-shrub communities on the outcrops of chalk and marl rocks of the south of the Orenburg region and North-West Kazakhstan within the steppe (subzones of the true and desert steppes) and desert zone. The central order, Anabasietalia cretaceae Golovanov ord. nov. hoc loco, is described;holotypus is alliance Anthemido trotzkianae–Artemision salsoloidis all. nov. hoc loco. Three alliances identified within the order reflect both community distribution along the latitudinal gradient and succession stages. The alliance Sileno fruticulosae–Nanophytonion erinacei Lebedeva all. nov hoc loco is poor-species communities, located mainly on the chalk massifs in the southern part of the Sub-Ural Plateau (Emben Plateau) and adjacent territories. Holotypus of the alliance is ass. Onosmo staminei–Anabasietum cretaceae ass. nov. hoc loco with highly constant desert plant species (Anabasis salsa, Artemisia terrae-albae, Atriplex cana, Limonium suffruticosum, Rhammatophyllum pachyrhizum, etc.). It includes the ass. Onos­mo staminei–Anabasietum cretaceae ass. nov. hoc loco (Table 3, syntaxa 1–3; Tables 4–6). Holotypus hoc loco: Table 4, rel. no. 9 (YS19-034): Republic of Kazakhstan, Atyrau region, Zhylyojskij district, 10 km W Aktologay ridge, 47.48514° N, 54.97647° E, 19.05.2019, collector Yamalov S. M.) The alliance Anabasio cretaceae–Agropyrion desertorum Korolyuk all. nov hoc loco.Holotypus is ass. Agropyro desertorum–Artemisietum lessingianae ass. nov. hoc loco. Alliance includes communities in flat habitats with well-developed soils at the foot of the chalk hills in the central and northern parts of the Sub-Ural Plateau, on the chalk rock outflows, as well on their tops. Active are species of deserts and galophytic communities of the classes Artemisietea lerchianae and Festuco-Puccinellietea, as well as these of dry and desert steppes of the order Tanaceto achilleifolii–Stipetalia lessingianae. There are 2 associations: Agropyro desertorum–Artemisietum lessingianae ass. nov. hoc loco (Table 3, syntaxon 4; Table 7; fig. 23; holotypus hoc loco: Table 7, rel. no 8 (YS15-019)), Russian Federation, Orenburg region, Sol-Ilets­kiy district, Troitsk Chalk Mountains, 10 km SW vil. Troitsk, 50.65317° N, 54.542° W, 06.06.2015, collector Yamalov S. M.) and Psephello marschallianae–Artemisietum lerchianae ass. nov. hoc loco ((Table. 3, syntaxon 5; Table 8; fig. 24); holotypus hoc loco: Table 8, rel. no 15 (YS19-050), Republic of Kazakhstan, Aktyubinsk region, Hobdinsky district, chalk mountains 16 km NE vil. Zhantalap, 50.39986° N, 56.05054° N, 21.05.2019, collector Yamalov S. M.). The alliance Anthemido trotzkianae–Artemision salsoloidis Yamalov all. nov hoc loco.Holotypus is ass. Anthemido trotzkianae–Artemisietum salsoloi­dis ass. nov. Alliance includes the cenoses of the chalk highlands of the Sub-Ural Plateau (except for its extremely southern part) and the Obschiy Syrt. These are both communities of the initial and more advanced succession stages. The high constancy of Anthemis trotzkiana and Artemisia salsoloides, as well as the presence of petrophytic species widely distributed in the rocky steppes of the Southern Ural (Alyssum tortuosum, Centaurea marchalliana, Euphorbia seguieriana, Galium octonarium) are character for the alliance cenophlora. There are three associations— Nanophytono erinacei–Jurinetum kirghisori ass. nov. hoc loco (Table 3, syntaxon 6; Table 9; Fig. 25; holotypus hoc loco: Table 9, rel. no 7 (GY18-070)), Russian Federation, Orenburg region, Sol-Iletskiy district, Verhnechibendinskie Chalk Mountains, 10 km W vil. Troitsk, 50.6562° N, 54.44272° W, 07.06.2016, collector Golovanov Ya. M.); Anthemido trotzkianae–Artemisietum salsoloidis ass. nov. hoc loco (Table 3, syntaxa 7, 8; Tables 10, 11; Fig. 26; holotypus hoc loco: Table 10, rel. no 20 (GY15-047)), Russian Federation, Orenburg region, Sol-Iletskiy district, Troitsk Chalk Mountains, 10 km NW vil. Troitsk, 50.65267° N, 54.54217° E, 06.06.2015, collector Golovanov Ya. M.); Onosmo simplicissimae–Anthemietum trotzkianae ass. nov. hoc loco (Table 3, syntaxon 9; tab. 12; Fig. 27); holotypus hoc loco: Table 12, rel. no 1 (GY19-011)), Republic of Kazakhstan, Aktyubinsk region, Uilskii district, Terektytau, 10 km NE vil. Akshatau, 49.43507° N, 54.60127° E, 15.05.2019, collector — Golovanov Ya. M.). There are 2 associations in the class Festuco-Brometea. Within the dry steppe order Tanaceto achilleifolii–Stipetalia lessingianae this is Bassio prostratae–Agropyretum desertorum ass. nov. hoc loco (Table 3, syntaxa 10, 11; Table 13), holotypus hoc loco: Table 13, rel. no 8 (GY19-004)), Republic of Kazakhstan, Aktyubinsk region, Uilskii district, Terektytau, 10 km NE vil. Akshatau, 49.42942° N, 54.60047° E, 15.05.2019, collector Golovanov Ya. M.); within the true steppe order Helictotricho-Stipetalia this isass. Anthemido trotzkianae–Thymetum guberlinensis ass. nov. hoc loco (Table 3, syntaxon 12; Table 14); holotypus hoc loco: Table 14, rel. no 8 (GY14-012)), Russian Federation, Orenburg region, Gayskii district, chalk mountain Dyurtel, 4 km NE vil. Starohalilovo, 51.504° N, 58.157° E, 27.06.2014, collector Golovanov Ya. M.). The result of the research of chalk outcrops ve­getation of Sub-Ural plateau and adjacent territories is new class Anabasietea cretaceae which includes 1 order, 3 alliances, 6 associations, 3 subassociations, 2 variants and 9 facies.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Summary This work describes simulation of well productivity reduction due to near-well flow restrictions. The flow restrictions considered include: mechanical skin, partial completion, altered formation due to residual completion fluid or liquid dropout, and non-Darcy flow effects. It addresses two specific issues. The first is how to predict changes in well performance induced by changes in near-well parameters, as needed in history matching and well test analysis. A subset of this issue is how to estimate the impact of using well parameters to simplify simulation models such as partial completion skin and non-Darcy flow skin, instead of using more layers and solving the non-Darcy flow equation. The second issue is how to accurately preserve well productivity in a large grid block, as in the case of well productivity reduced by liquid dropout in a gas condensate reservoir model. To resolve these issues, this work uses direct simulation and heuristic total skin equations developed for one-dimensional and two-dimensional multilayered cases with crossflow. The equation correctly represents the effects of nonlinear interactions among near-well flow restrictions on well productivity, resulting in an effective total skin that is much larger than the conventional linear sum of individual skin components. Numerical examples show the total skin equation can be used to predict well performance and to accurately preserve well productivity in a field-scale gas condensate reservoir model. The latter use of the equation shows a feedback mechanism, wherein the total skin is used to adjust the coarse-grid well productivity. Introduction Accurate well representation is a most challenging task in reservoir simulation. It affects reservoir characterization, history matching, and in turn, the quality of well and reservoir performance simulation. Therefore, well modeling has been intensely researched. However, the task still depends very much on a simulation engineer's subjective judgment. This has several reasons. First, we often do not fully understand complex physical phenomena around a wellbore. Second, we cannot properly keep track of flow paths in the near-well region controlled by wellbore geometry, completion and stimulation practices, and well operations. Third, we do not have an accurate description on formation properties around a wellbore. Fourth, our reservoir simulators and engineering tools used have limitations. Therefore, a simulation engineer goes through a series of trade-off analyses before selecting proper well representation. The simplest way to calculate well deliverability is to use the well performance equation. We consider the pseudo-steady-state (PSS) gas flow. Then, the well deliverability and productivity index (J) can be represented by Eqs. 1 and 2 with pseudo-gas-potential m(p):1 q g = J [ m ( P ￣ R ) − m ( p w f ) ] , ( 1 ) where J = q g { m ( P ￣ R ) − m ( p w f ) } = C k g h { l n ( r e r w ) − 0.75 + S T } , ( 2 ) where h is total formation thickness, kg gas permeability, qg gas flow rate, P￣R average reservoir pressure, pwf flowing bottomhole pressure, rw wellbore radius, re reservoir radius, and C a conversion constant. For oil or water flow, pressure replaces the pseudopotential with proper changes in conversion constant and fluid properties. Eq. 2 relates J to flow potential difference, formation flow capacity (kgh) and near-well flow restrictions represented as the total skin (ST) Eq. 1 is the simplest reservoir simulator. Alternatively, a regular reservoir simulator can be used for well deliverability calculation, solving mass and momentum conservation equations. In this case, the deliverability calculation can be divided into two parts: from deep in reservoir to the near-well region, and from the near-well region into a wellbore. The well representation is more concerned with the second part. The corresponding flow equation is called the well equation. A typical well equation for a vertical well is given as2 q g = I W ( k r g ρ g / μ g ) [ m ( p r e f ) − m ( p w f ) ] , ( 3 ) I w = k Δ z / [ l n ( r r e f / r w ) + S ] , ( 4 ) where Iw is the well index, and rref the radial distance to the center of the first grid in a radial grid (or Peaceman's radius in a rectangular grid) where rref is defined. The well performance equation, Eq. 1, deals with the whole reservoir. Its parameters capture the effect of all well and reservoir properties distributed over the reservoir. Meanwhile, the well equation, Eq. 3, deals only with the fluid flow around a wellbore. Its parameters reflect the corresponding local properties. Thus, it is difficult to directly relate Eq. 3 to the well deliverability of Eq. 1. A good example is skin, the dimensionless pressure drop at the well-reservoir interface (sandface). The total skin in Eq. 2 represents the total pressure drop due to all flow restrictions in the near-well region, while the skin in Eq. 3 deals only with the pressure drop at the sandface caused by wellbore damage (mechanical skin). However, Eq. 1 and the reservoir simulator using Eq. 3 should give the same deliverability for the same reservoir. Near-Well Flow Restrictions. The near-well flow restrictions control well deliverability. The accuracy of the computed well deliverability depends on how the flow restrictions are represented. Those near-well flow restrictions are often called skin effects. There are several kinds of skin effects, and they are fluid-dynamically interacting with each other.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

ABSTRACT After the obduction of the Semail ophiolitic nappe onto the Arabian Platform in the Late Cretaceous, north Oman underwent several phases of extension before being affected by compression in the framework of the Arabia-Eurasia convergence. A tectonic survey, based on structural analysis of fault-slip data in the post-nappe units of the Oman Mountains, allowed us to identify major events of the Late Cretaceous and Cenozoic tectonic history of northern Oman. An early ENE-WSW extensional phase is indicated by synsedimentary normal faults in the Upper Cretaceous to lower Eocene formations. This extensional phase, which immediately followed ductile extension and exhumation of high-pressure rocks in the Saih Hatat region of the Oman Mountains, is associated with large-scale normal faulting in the northeast Oman margin and the development of the Abat Basin. A second extensional phase, recorded in lower Oligocene formations and only documented by minor structures, is characterized by NNE (N20°E) and NW (N150°E) oriented extensions. It is interpreted as the far-field effect of the Oligocene-Miocene rifting in the Gulf of Aden. A late E-W to NE-SW directed compressional phase started in the late Oligocene or early Miocene, shortly after the collision in the Zagros Mountains. It is attested by folding, and strike-slip and reverse faulting in the Cenozoic series. The direction of compression changed from ENE-WSW in the Early Miocene to almost N-S in the Pliocene.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Abstract. The Pevek region of Arctic Russia provides excellent beach cliff exposure of sedimentary and igneous rocks that yield detailed information on the nature, progression and timing of structural events in this region. Regional folding and thrust faulting, with the development of a south-dipping axial plane cleavage/foliation developed during N-S to NE-SW directed shortening and formation of the Chukotka-Anyui fold belt. This deformation involves strata as young as Valanginian (136–140 Ma, Gradstein et al., 2004). Fold-related structures are cut by intermediate to silicic batholiths, plutons and dikes of Cretaceous age. Reported K-Ar whole rock and mineral ages on the granitoids range from 144 to 85 Ma, but to the south, more reliable U-Pb zircon ages on compositionally similar plutons yield a much narrower age range of ~120–105 Ma (Miller et al., this volume) and a pluton in Pevek yields a U-Pb age on zircon of 108.1±1.1 Ma with evidence for inheritance of slightly older 115 Ma zircons. Magmas were intruded during an episode of E-W to ENE-WSW directed regional extension based on the consistent N-S to NNW-SSE orientation of over 800 mapped dikes and quartz veins. Analysis of small-offset faults and slickensides yield results compatible with those inferred from the dikes. Younger tectonic activity across this region is minor and the locus of magmatic activity moved southward towards the Pacific margin as represented by the <90 Ma Okhotsk-Chukotsk volcanic belt (OCVB). A lengthy period of uplift and erosion occurred after emplacement of Cretaceous plutons and produced the peneplain beneath the younger OCVB. Based on our studies, we speculate that ~120–105 Ma magmatism, which heralds a change in tectonic regime from compression to extension, could represent one of the consequences of the inception of rifting in the Amerasian Basin of the Arctic, forming the Makarov Basin north of the Siberian shelf at this longitude. A synthesis of available seismic reflection, gravity and magnetic data for the offshore Siberian Shelf reveals a widespread, seismically mappable basem*nt-sedimentary cover contact that deepens northward towards the edge of the shelf with few other significant basins. Various ages have been assigned to the oldest strata above the unconformity, ranging from Cretaceous (Albian – 112–100 Ma) to Tertiary (Paleocene–Eocene – ~60–50 Ma). The period of uplift and erosion documented along the Arctic coast of Russia at this longitude could represent the landward equivalent of the (yet undrilled) offshore basem*nt-sedimentary cover contact, thus overlying sedimentary sequences could be as old as early Late Cretaceous. Although quite speculative, these conclusions suggest that land-based geologic, structural, petrologic and geochronologic studies could provide useful constraints to help resolve the plate tectonic history of the Arctic Ocean.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Aim. As the nearest large spiral galaxy, M 31 provides a unique opportunity to study the structure and evolutionary history of this galaxy type in great detail. Among the many observing programs aimed at M 31 are microlensing studies, which require good three-dimensional models of the stellar mass distribution. Possible non-axisymmetric structures like a bar need to be taken into account. Due to M 31’s high inclination, the bar is difficult to detect in photometry alone. Therefore, detailed kinematic measurements are needed to constrain the possible existence and position of a bar in M 31.Methods. We obtained ≈220 separate fields with the optical integral-field unit spectrograph VIRUS-W, covering the whole bulge region of M 31 and parts of the disk. We derived stellar line-of-sight velocity distributions from the stellar absorption lines, as well as velocity distributions and line fluxes of the emission lines Hβ, [O III] and [N I]. Our data supersede any previous study in terms of spatial coverage and spectral resolution.Results. We find several features that are indicative of a bar in the kinematics of the stars, we see intermediate plateaus in the velocity and the velocity dispersion, and correlation between the higher moment h3 and the velocity. The gas kinematics is highly irregular, but is consistent with non-triaxial streaming motions caused by a bar. The morphology of the gas shows a spiral pattern, with seemingly lower inclination than the stellar disk. We also look at the ionization mechanisms of the gas, which happens mostly through shocks and not through starbursts.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

ABSTRACT: Asia is the second region after Africa to have the tallest prevalence of stunting in the world. Indonesia is one of the countries in Southeast Asia with the fifth highest prevalence of stunting in the world at 37%, or nearly 9 million children who experience stunting. This study aims to examine the factors that influence and risk the occurrence of stunting in children in Indonesia. The research method uses a type of qualitative research with a traditional literature review. This study found that stunting is influenced by several complex factors not only at the individual level but also at the family and community levels. A comprehensive synthesis of the available evidence on the determinants of stunting in children in Indonesia outlines who is most vulnerable to stunting, which interventions are successful, and what new research is needed to fill knowledge gaps. Keywords: Indonesian toddlers, stunting factors References: Adair, L. S., & Guilkey, D. K. (1997). Age-specific Determinants of Stunting in Filipino Children. The Journal of Nutrition, 127(2), 314–320. https://doi.org/10.1093/jn/127.2.314 Akombi, B. J., Agho, K. E., Hall, J. J., Merom, D., Astell-Burt, T., & Renzaho, A. M. N. (2017). Stunting and Severe Stunting Among Children Under-5 Years in Nigeria: A Multilevel Analysis. BMC Pediatrics, 17(1), 1–16. https://doi.org/10.1186/s12887-016-0770-z Asfaw, M., Wondaferash, M., Taha, M., & Dube, L. (2015). Prevalence of Undernutrition and Associated Factors Among Children Aged Between Six to Fifty Nine Months in Bule Hora District, South Ethiopia. BMC Public Health,15(1), 41. https://doi.org/10.1186/s12889-015-1370-9 Badan Penelitian dan Pengembangan Kesehatan. (2018). Hasil Utama RISKESDAS 2018. Bardosono, S., Sastroamidjojo, S., & Lukito, W. (2007). Determinants of Child Malnutrition During the 1999 Economic Crisis in Selected Poor Areas of Indonesia. Asia Pacific Journal of Clinical Nutrition, 16(3), 512–526. Best, C. M., Sun, K., De Pee, S., Sari, M., Bloem, M. W., & Semba, R. D. (2008). Paternal Smoking and Increased Risk of Child Malnutrition Among Families in Rural Indonesia. Tobacco Control, 17(1), 38–45. https://doi.org/10.1136/tc.2007.020875 Biadgilign, S., Shumetie, A., & Yesigat, H. (2016). Does Economic Growth Reduce Childhood Undernutrition in Ethiopia? PLoS ONE, 11(8), 1–14. https://doi.org/10.1371/journal.pone.0160050 Black, R. E., Victoria, C. G., Walker, S. P., Bhutta, Z. A., Christian, P., Onis, M. de, Ezzati, M., McGregor, S. G., Katz, J., Martorell, R., Uauy, R., & The Maternal and Child Nutrition Study Group. (2013). Maternal and Child Undernutrition and Overweight in Low-income and Middle-income Countries. The Lancet, 382, 396. Budge, S., Parker, A. H., Hutchings, P. T., & Garbutt, C. (2019). Environmental Enteric Dysfunction and Child Stunting. Nutrition Reviews, 77(4), 240–253. https://doi.org/10.1093/nutrit/nuy068 Burchi, F. (2010). Child Nutrition in Mozambique in 2003: The Role of Mother’s Schooling and Nutrition Knowledge. Economics and Human Biology, 8(3), 331–345. https://doi.org/10.1016/j.ehb.2010.05.010 Casale, D., Espi, G., & Norris, S. A. (2018). Estimating the pathways through which maternal education affects stunting: Evidence from an urban cohort in South Africa. 21(10), 1810–1818. https://doi.org/10.1017/S1368980018000125 Casanovas, M. del C., Lutter, C. K., Mangasaryan, N., Mwadime, R., Hajeebhoy, N., Aguilar, A. M., Kopp, C., Rico, L., Ibiett, G., Andia, D., & Onyango, A. W. (2013). Multi-sectoral Intervensions for Healthy Growth. Matern Child Nutrition, 2, 46–57. https://doi.org/10.1111/mcn.12082 Chirande, L., Charwe, D., Mbwana, H., Victor, R., Kimboka, S., Issaka, A. I., Baines, S. K., Dibley, M. J., & Agho, K. E. (2015). Determinants of Stunting and Severe Stunting Among Under-Fives in Tanzania: Evidence from The 2010 Cross-sectional Household Survey. BMC Pediatrics, 15(1), 1–13. https://doi.org/10.1186/s12887-015-0482-9 Creswell, J. W. (2014). A Concise Introduction to Mixed Methods Research. SAGE Publications Inc. Dao, D., Thang, V. Van, & Hoa, D. T. (2010). Malnutrition Status and Related Factors Within Ethnic Minority Children Under 5 Years Old in North Tra My District, Quang Nam Province in 2010. Journal of Science, 61. Fantay Gebru, K., Mekonnen Haileselassie, W., Haftom Temesgen, A., Oumer Seid, A., & Afework Mulugeta, B. (2019). Determinants of Stunting Among Under-Five Children in Ethiopia: A Multilevel Mixed-Effects Analysis of 2016 Ethiopian Demographic and Health Survey Data. BMC Pediatrics, 19(1), 1–13. https://doi.org/10.1186/s12887-019-1545-0 Fitri, L. (2018). Hubungan BBLR dan ASI Eksklusif Dengan Kejadian Stunting di Puskesmas Lima Puluh Pekanbaru. Jurnal Endurance, 3(1), 131–137. Goldstein, H. (2010). Multilevel Statistical Models, 4th Edition. Wiley. Handayani, F., Siagian, A., & Aritonang, E. (2017). Mother’s Education as A Determinant of Stunting among Children of Age 24 to 59 Months in North Sumatera Province of Indonesia. IOSR Journal of Humanities and Social Science, 22, 58–64. https://doi.org/10.9790/0837-2206095864 Hendraswari, C. A., Purnamaningrum, Y. E., Maryani, T., Widyastuti, Y., & Harith, S. (2021). The Determinants of Stunting for Children Aged 24-59 Months in Kulon Progo District 2019. Kesmas: Jurnal Kesehatan Masyarakat Nasional, 16(2), 71–77. https://doi.org/10.21109/kesmas.v16i2.3305 Hoddinott, J., Alderman, H., Behrman, J. R., Haddad, L., & Horton, S. (2013). The Economic Rationale For Investing In Stunting Reduction. Maternal & Child Nutrition, 9, 69–82. https://doi.org/10.1111/mcn.12080 Horrell, S., Humphries, J., & Voth, H.-J. (2001). Destined for Deprivation: Human Capital Formation and Intergenerational Poverty in Nineteenth-Century England. Explorations in Economic History, 38(3), 339–365. https://doi.org/10.1006/exeh.2000.0765 International Food Policy Research Institute. (2016). Global Nutrition Report 2016: From Premise to Impact: Ending Malnutrition by 2030. Kementerian Kesehatan Republik Indonesia. (2016). InfoDATIN: Situasi Balita Pendek. Kementerian Kesehatan Republik Indonesia. (2018). Warta KESMAS: Cegah Stunting itu Penting. Kimani-Murage, E. W., Muthuri, S. K., Oti, S. O., Mutua, M. K., Van De Vijver, S., & Kyobutungi, C. (2015). Evidence of A Double Burden of Malnutrition in Urban Poor Settings in Nairobi, Kenya. PLoS ONE, 10(6), 1–17. https://doi.org/10.1371/journal.pone.0129943 Kusumawati, E., Rahardjo, S., & Sari, H. P. (2015). Model Pengendalian Faktor Risiko Stunting pada Anak Usia di Bawah Tiga Tahun Model of Stunting Risk Factor Control among Children under Three Years. Kesmas: Jurnal Kesehatan Masyarakat Nasional, 9, 249–256. Madan, E. M., Haas, J. D., Menon, Purnima., & Gillespie, Stuart. (2018). Seasonal Variation In The Proximal Determinants Of Undernutrition During The First 1000 Days Of Life In Rural South Asia: A Comprehensive Review.Global Food Security, 19, 11–23. https://doi.org/10.1016/j.gfs.2018.08.008 McGregor, S. G., Cheung, Y. B., Cueto, S., Glewwe, P., Ritcher, L., Strupp, B., & International Child Development Steering Group. (2007). Developmental Potential in The First 5 Years for Children in Developing Countries. The Lancet, 369, 60–70. https://doi.org/10.1016/S0140-6736(07)60032-4 Mugianti, S., Mulyadi, A., Anam, A. K., & Najah, Z. L. (2018). Faktor Penyebab Anak Stunting Usia 25-60 Bulan di Kecamatan Sukorejo Kota Blitar. Jurnal Ners Dan Kebidanan (Journal of Ners and Midwifery), 5(3), 268–278. https://doi.org/10.26699/jnk.v5i3.art.p268-278 Ntenda, P. A. M., & Chuang, Y.-C. (2018). Analysis of Individual-level and Community-level Effects on Childhood Undernutrition in Malawi. Pediatr Neonatol, 59(4), 380–389. https://doi.org/10.1016/j.pedneo.2017.11.019 Oddo, V. M., Rah, J. H., Semba, R. D., Sun, K., Akhter, N., Sari, M., De Pee, S., Moench-Pfanner, R., Bloem, M., & Kraemer, K. (2012). Predictors of Maternal and Child Double Burden of Malnutrition in Rural Indonesia and Bangladesh. American Journal of Clinical Nutrition, 95(4), 951–958. https://doi.org/10.3945/ajcn.111.026070 Prado, E. L., & Dewey, K. G. (2014). Nutrition and brain development in early life. Nutrition Reviews, 72(4), 267–284. https://doi.org/10.1111/nure.12102 Prakhasita, R. C. (2019). Hubungan Pola Pemberian Makan Dengan Kejadian Stunting Pada Balita Usia 12-59 Bulan di Wilayah Kerja Puskesmas Wedi Surabaya. Universitas Airlangga. Reynaldo, Martorell., & Young, M. F. (2012). Patterns of Stunting and Wasting: Potential Explanatory Factors. Advances in Nutrition, 3(2), 227–233. https://doi.org/10.3945/an.111.001107 Rosiyati, E., Pratiwi, E. A. D., Poristinawati, I., Rahmawati, E., Nurbayani, R., Lestari, S., Wardani, P. S., & Nugroho, M. R. (2019). Determinants of Stunting Children (0-59 Months) in Some Countries in Southeast Asia. Jurnal Kesehatan Komunitas, 4(3), 88–94. https://doi.org/10.25311/keskom.vol4.iss3.262 Sari, M., De Pee, S., Bloem, M. W., Sun, K., Thorne-Lyman, A. L., Moench-Pfanner, R., Akhter, N., Kraemer, K., & Semba, R. D. (2010). Higher Household Expenditure on Animal-Source and Nongrain Foods Lowers the Risk of Stunting Among Children 0-59 Months Old in Indonesia: Implications of Rising Food Prices. Journal of Nutrition, 140(1), 195–200. https://doi.org/10.3945/jn.109.110858 Satriawan, E. (2018). Strategi Nasional Percepatan Pencegahan Stunting 2018-2024. [National Strategy for the Acceleration of Stunting Prevention] Semba, R. D., Kalm, L. M., De Pee, S., Ricks, M. O., Sari, M., & Bloem, M. W. (2007). Paternal Smoking is Associated with Increased Risk of Child Malnutrition Among Poor Urban Families in Indonesia. Public Health Nutrition, 10(1), 7–15. https://doi.org/10.1017/S136898000722292X Semba, R. D., Moench-Pfanner, R., Sun, K., De Pee, S., Akhter, N., Rah, J. H., Campbell, A. A., Badham, J., Bloem, M. W., & Kraemer, K. (2011). Consumption of Micronutrient-fortified Milk and Noodles is Associated with Lower Risk of Stunting in Preschool-Aged Children in Indonesia. Food and Nutrition Bulletin, 32(4), 347–353. https://doi.org/10.1177/156482651103200406 Shieh, S. J., Chen, H. L., Liu, F. C., Liou, C. C., Lin, Y. in H., Tseng, H. I., & Wang, R. H. (2010). The Effectiveness of Structured Discharge Education on Maternal Confidence, Caring Knowledge, and Growth of Premature Newborns. Journal of Clinical Nursing, 19(23–24), 3307–3313. https://doi.org/10.1111/j.1365-2702.2010.03382.x Stewart, C. P., Iannotti, L., Dewey, K. G., Michaelsen, K. F., & Onyango, A. W. (2013). Contextualising Complementary Feeding in a Broader Framework for Stunting Prevention. Matern Child Nutrition, 9(2), 27–45. https://doi.org/10.1111/mcn.12088 Tim Nasional Percepatan Penanggulangan Kemiskinan. (2017). 100 Kabupaten/Kota Prioritas Untuk Intervensi Anak Kerdil (Stunting). Titaley, C. R., Ariawan, I., Hapsari, D., Muasyaroh, A., & Dibley, M. J. (2013). Determinants of the Stunting of Children in Indonesia: A Multilevel Analysis of the 2013 Indonesia Basic Health Survey. Nutrients, 11, 1160. UNICEF. (2015a). UNICEF’ s Approach to Scaling Up Nutrition for Mothers and Their Children. Programme Division, February 9. UNICEF. (2015b). UNICEF’s Approach to Scalling Up Nutrition For Mothers and Their Children. UNICEF. (2018). Progress For Every Child in The SDG Era. United Nations. (2021). United Nations Sustainable Development Goal 2: Zero Hunger. https://sdgs.un.org/goals/goal2 United Nations Children’s Fund. (2013). Improving Child Nutrition: The Achievable Imperative for Global Progress. Worku, B. N., Abessa, T. G., Wondafrash, M., Vanvuchelen, M., Bruckers, L., & Kolsteren, P. (2018). The Relationship of Undernutrition/Psychosocial Factors and Developmental Outcomes of Children in Extreme Poverty in Ethiopia. BMC Pediatrics, 18(1), 1–9. http://dx.doi.org/10.1186/s12887-018-1009-y World Bank Group. (2016). World Development Report 2016: Digital Dividends. World Health Organization. (2010). Nutrition Landscape Information System (NLIS) Country Profile Indicators: Interpretation Guide. World Health Organization. (2012). The Sixty Fifth World Health Assembly: Maternal, Infant, and Young Child Nutrition. World Health Organization. (2014). Global Nutrition Targets 2025: Stunting Policy Brief (No.WHO/NMH/NHD/14.3).

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

SUMMARY The Sunda Plate has shaped itself in a complex tectonic framework, driven by the interactions of multiple subduction zones in its history. Using thermomechanical computational fluid dynamic models we show in this paper how the in-dip double-subduction dynamics has controlled the first-order 3-D topography of this plate, currently bounded by two major N–S trending active trenches: Andaman–Sumatra–Java and Philippines on its western and eastern margins, respectively. We consider six E–W transects to account for an along-trench variation of the subduction parameters: subduction rate (Vc), shallow-depth (200–300 km) slab dip (α) and intertrench distance (ITD, λ) in our 2-D numerical experiments. The deviatoric stress fields and the topographic patterns are found to strongly depend on λ. For large ITDs (λ = 2000–3000 km), the overriding plate develops dominantly tensile stresses in its central zone, forming low topographic elevations. Decreasing λ results in a transition from extensional to contractional deformation, and promotes topographic uplift in the southern part. We explain these effects of λ in terms of the sublithospheric flow vortex patterns produced by the subducting slabs. Large λ (&gt; 2000 km) generates non-interacting flow vortices, located close to the two trenches, leaving the mantle region beneath the overriding plate weakly perturbed. In contrast, small λ results in their strong interaction to produce a single upwelling zone, which facilitates the overriding plate to gain a higher topographic elevation. The stress field predicted from our model is validated with the observed stress patterns. We also interpolate a 3-D topographic surface and vertical uplift rates from the serial model sections, and compare them with the observed surface topography of the Sunda Plate.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Abstract Background: Hypercalcemia is a commonly encountered clinical problem with numerous etiologies. Granulomas formed secondary to foreign bodies are a rare but increasingly recognized cause of hypercalcemia. Clinical Case: A 49-year old African American woman, who had received silicone injections for buttock augmentation 15 years ago, was found to have severe hypercalcemia after she presented with complaints of chronic constipation, muscle cramping, polyuria, and mental fog. Her labs on admission showed severe hypercalcemia Ca 17.9mg/dL (normal: 8.4–10.6 mg/dL), with a suppressed PTH 4 pg/mL (normal 14–54 pg/mL). Prior labs from 5 years earlier, had shown an elevated 1,25(OH)2D, therefore differentials including lymphoma and chronic granulomatous diseases, particularly sarcoidosis, were high on the list of possible diagnosis. Additional labs showed a normal PTH-RP 19 pg/mL (normal 14–27 pg/mL), normal ACE levels 64 U/L (normal 9–67 U/L), low 25(OH)D2 1 ng/mL and normal 1,25(OH)2D 62 pg/mL. Her exam was notable for multiple indurated and firm masses palpable over the bilateral gluteal region and lateral thighs. CT abdomen/pelvis showed extensive and markedly confluent infiltration with intervening globules of macroscopic fat throughout the subcutaneous fat layers of the buttocks and lateral hips and speckled linear calcifications consistent with granulomatous reaction. With aggressive fluid hydration and calcitonin, her calcium levels decreased over the following 48 hours, but remained at 12–13 mg/dL. She was started on 30 mg of prednisone daily and her calcium levels dropped to 10.9 mg/dL the following day. She was discharged home on prednisone, her calcium levels remained suppressed, and her prednisone dose was slowly tapered during the following months. She was referred for plastic surgery evaluation and is being evaluated for possible surgical debridement. Conclusion: Hypercalcemia secondary to foreign body granulomas is a rare clinical entity. The diagnosis is usually established through a thorough history and examination. Lab findings may be variable. Treatment of these patients can be challenging, and corticosteroids are the mainstay of treatment in most cases1. Surgical debridement of granulomas has been reported with good results; however, further investigation and longer follow-up is needed2. References: 1.Tachamo, N., Donato, A., Timilsina, B., Nazir, S., Lohani, S., Dhital, R., & Basnet, S. Hypercalcemia associated with cosmetic injections: A systematic review. European Journal of Endocrinology, 2018; 178(4): 425–4302.Edwards, B.J., Saraykar, S., Suna, M., Murphy, W. A., Lin, P., Gagel, R. Resection of granulomatous tissue resolves silicone induced hypercalcemia, Bone Reports, 2016; 5:163–7

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

The Alpine orogenic belt of the Hellenides has been strongly reworked by ductile and brittle extensional tectonics. Extensional structures have affected the central Aegean region and obliterated much of the original orogenic architecture since at least early Miocene times. In the area of Almyropotamos (on the island of Evia, flanking the western part of the Aegean) a unique remnant compressional nappe stack involving Tertiary metamorphic rocks has been preserved. This nappe sequence comprises a high-pressure rock unit on top of a lower grade unit. The upper unit (South Evia Blueschist Belt) is thought to be the westward continuation of the Cycladic blueschist belt metamorphosed at high-pressure conditions during Late Cretaceous–Eocene times. The underlying unit (the Almyropotamos Unit) is a continental margin sequence covered by a flysch and containing Lutetian nummulites, indicating that this unit accumulated sediments until at least late Eocene times.In the present study we analyse the petrology of the Almyropotamos nappe stack and define the P–T conditions of each of the different rock units exposed there. The presence of glaucophane, lawsonite rimmed by epidote, and jadeite (70 mol.%) suggest that peak P–T conditions in the South Evia Blueschist Belt reached approximately 10–12 kbar and 350–450 °C. Unlike previous studies, which estimated that the underlying Almyropotamos Unit reached only greenschist-facies conditions, glaucophane relics and Si-rich phengites were found by us in this unit. These indicate that high-pressure metamorphism and crustal thickening in this part of the Aegean lasted until at least the late Eocene or early Oligocene. We note that in this respect the architecture of southern Evia resembles that of northern Greece (Olympos, Ossa). Our structural data indicate that rock units in the Almyropotamos area record different folding phases, with the South Evia Blueschist Belt having a more complex fold history than the underlying Almyropotamos Unit. The entire nappe stack shares large-scale folds which are E–W trending, and locally overturned-to-the-south, and which may represent (at present coordinates) N–S contraction and nappe transport.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

This study aims to determine the effect of the whole language approach to the ability to read and write in English in early stages of children aged 5-6 years in one of the kindergartens in the Yogyakarta Special Region. The population in this study were 43 children who were in the age range of 5-6 years in the kindergarten. Twenty-nine participants were included in the experimental class subjects as well as the control class with posttest only control group design. Observation is a way to record data in research on early reading and writing ability. The results of Multivariate Anal- ysis of Covariance (Manova) to the data shows that 1) there is a difference in ability between the application of the whole language approach and the conventional approach to the ability to read the beginning of English; 2) there is a difference in ability between applying a whole language approach and a conventional approach to writing English beginning skills; 3) there is a difference in ability between the whole language approach and the conventional approach to the ability to read and write the beginning in English Keywords: Whole language approach, Early reading, Early writing, Early childhood Reference Abdurrahman, M. (2003). Pendidikan bagi Anak Berkesulitan Belajar. Jakarta: Rineka Cipta. Aisyah, S., Yarmi, G., & Bintoro, T. (2018). Pendekatan Whole Language dalam Pengembangan Kemampuan Membaca Permulaan Siswa Sekolah Dasar. Prosiding Seminar Nasional Pendidikan, 160–163. Alhaddad, A. S. (2014). Joedanian Literacy Education Should Whole Language be Implemented? European Scientific Journal, 10(8). Aulina, C. N., & Rezania, V. (2013). Metode Whole Language untuk Pembelajaran Bahasa Pada Anak TK. Pendidikan Usia Dini. Austring, B. D., & Sørensen, M. (2012). A Scandinavian View on the Aesthetics as a Learning Media. Journal of Modern Education Review, 2(2), 90–101. Cahyani, H., Courcy, M. de, & Barnett, J. (2018). Teachers’ code-switching in bilingual classrooms: exploring pedagogical and sociocultural functions. International Journal of Bilingual Education and Bilingualism, 21(4), 465–479. Cahyani, W. A. (2019). Pengembangan Model Pembelajaran Membaca pada Anak Usia Dini. Universitas Negeri Yogyakarta. CCSU NEWS. (2019). World’s Most Literate Nations Ranked. In WORLD’S MOST LITERATE NATIONS RANKED. Chodidjah, I. (2007). Teacher training for low proficiency level primary English language teachers: How it is working in Indonesia. In British Council (Ed.) Primary Innovations: A Collection of Papers, 87–94. Crystal, D. (2003). The Cambridge Encyclopedia of the English Language (second Edi). Cambridge: Cambridge University Press. Dhieni, N., Fridani, L., Muis, A., & Yarmi, G. (2014). Metode Perkembangan Bahasa. Universitas Terbuka, 1(155.4), 1–28. Dixon, J., & Sumon, T. (1996). Whole Language: An Integrated Approach to Reading and Writing. Action-Learning Manuals for Adult Literacy, 4. Doman, G. (1985). Ajaklah Balita Anda Belajar Meembaca. Bandung: CV. Yrama Widya. Fat, N. (2015). Ranking Minat Baca Pelajar Indonesia. In Minat Baca Indonesia. Flores, N. (2013). Undoing Truth in Language Teaching: Toward a Paradigm of Linguistic Aesthetics. Working Papers in Educational Linguistics (WPEL), 28(2). Folkmann, M. N. (2010). Evaluating aesthetics in design: A phenomenological approach. The MIT Press, 26(1), 40–53. Froese, V. (1991). Whole Language Practice and Theory. Boston: Allyn and Bacon.Gagne, R. M., & Briggs, L. J. (1996). Principle of Instructional Design. New York: Richard and Winston.Gardner, H. (2013). Multiple Intelegences : The Theory in ractice a Reader. New York: Basic. Goodman, K. (1986). What‟s whole in whole language. Portsmouth: NH: Heinemann. Goodman, K. S. (1986). What’s Whole in Whole Language? A Parent/Teacher Guide to Children’s Learning. Heinemann Educational Books, Inc: 70 Court St., Portsmouth, NH 03801. Hammerby, H. (1982). Synthesis in Second Language Teaching. Blane: Second Language. Hardinansyah, V. (2017). Analisis Kebutuhan pada Pengajaran Bahasa Inggris di PG-PAUD. Jurnal Pendidikan Dan Pembelajaran Anak Usia Dini, 4(2), 92–102. Jamaris, M. (2006). Perkembangan dan Pengembangan Anak Usia Dini Taman Kanak-kanak. Jakarta: Gramedia Widiasarana. Krashen, S. D. (1981). Second Language Acquisition and Second Language Learning (Wesley Longman Ltd, ed.). Addison. Krashen, S., Long, M. H., & Scarcella, R. (1979). Accounting for child-adult differences in second language rate and attainment. TESOL Quarterly, 13, 573-82. Ling-Ying, & Huang. (2014). Learning to Read with the Whole Language Approach: The Teacher’s View. Canadian Center of Science and Education : English Language Teaching, 5(7). Ling, P. (2012). The “Whole Language” Theory and Its Application to the Teaching of English Reading. Journal of Canadian Center of Science and Education, 5(3). Maulidia, C. R., Fadillah, & Miranda, D. (2019). Pengaruh Pendekatan Whole Language Terhadap Kemampuan Membaca 5-6 Tahun di TK Mawar Khatulistiwa. Program Studi Pendidikan Guru PAUD FKIP Untan Pontianak, 8(7). Mayuni, I., & Akhadiah, S. (2016). Whole Language-Based English Reading Materials. International Journal of Applied Linguistics & English Literature, 5(3). Meha, N., & Roshonah, A. F. (2014). Implementasi Whole Language Approach sebagai Pengembangan Model Pembelajaran Berbahasa Awal Anak Usia 5-6 Tahun di PAUD Non Formal. Jurnal Pendidikan, 15(1), 68–82. Moats, L. (2007). Whole language high jinks: How to Tell When “Scientifically-Based Reading Instruction” Isn’t. Washington: Thomas B. Fordham Institute. Montessori, D. M. (1991). The discovery of the Child. New York: Ballatine Books.Morrow, L. M. (1993). Literacy Development in the Early Years. United States of America: Allyn & Bacon.Munandar, A. (2013). Pemakaian Bahasa Jawa Dalam Situasi Kontak Bahasa di Daerah Istimewa Yogyakarta. Jurnal Sastra Inggris, 25(1), 92–102. Musfiroh, T. (2009). Menumbuhkembangkan Baca-Tulis Anak Usia Dini. Yogyakarta: Grasindo. Nirwana. (2015). Peningkatan Kemampuan Membaca Cepat Melalui Pendekatan Whole Language pada Siswa Kelas VI SD Negeri 246 Bulu-Bulu Kecamatan Tonra Kabupaten Bone. Jurnal Onoma: Pendidikan, Bahasa, Dan Sastra, 1(1), 79-94., 1(1), 79–94. Novitasari, D. R. (2010). Pembangunan Media Pembelajaran Bahasa Inggris Untuk Siswa Kelas 1 Pada Sekolah Dasar Negeri 15 Sragen. Sentra Penelitian Engineering Dan Edukas, Volume 2 N. Oladele, A. O., & Oladele, I. T. (2016). Effectiveness of Collaborative Strategic Reading and Whole Language Approach on Reading Comprehension Performance of Children with Learning Disabilities in Oyo State Nigeria Adetoun. International Journal on Language, Literature and Culture in Education, 3(1), 1–24. Olusegun, B. S. (2015). Constructivism Learning Theory: A Paradigm for Teaching and Learning. Journal of Research & Method in Education, 5(6), 66–70. Ortega, L. (2009). Understanding Second Language Acquisition. New York: Routledge.Otto, B. (2015). Perkembangan Bahasa Pada Anak Usia DIni (third Edit). Jakarta: Prenadamedia. Papalia, D., Old, S., & Feldman, R. (2008). Human Development (Psikologi Perkembangan). Jakarta: Kencana. Papalia, Old, & Feldman. (2009). Human Development (Psikologi Perkembangan (Kesembilan). Jakarta: Kencana. Pellini, A. PISA worldwide ranking; Indonesia’s PISA results show need to use education resources more efficiently. , (2016). Phakiti, A. (2014). Experimental Research Methods in Language Learning. London: Bloomsbury Academic. Rahim, F. (2015). Pengajaran Bahasa di Sekolah Dasar. Jakarta: PT Bumi Aksara. Routman, R. (2014). Read, write, lead: Breakthrough strategies for schoolwide literacy success. Sadtono, E. (2007). A concise history of TEFL in Indonesia. English Education in Asia: History and Policies, 205–234. Sani, R.A. (2013). Inovasi Pembelajaran. Jakarta: Bumi Aksara.Sani, Ridwan A. (2013). Inovasi Pembelajaran. Jakarta: PT Bumi Aksara. Santrock, J. W. (2016). Children (Thirteenth). New York: McGraw-Hill Education. Saracho, O. N. (2017). Literacy and language: new developments in research, theory, and practice. Early Childhood Development and Care, 3(4), 187. https://doi.org/10.1080/03004430.2017.1282235 Semiawan, C. R. (1983). Memupuk Bakat dan Minat Kreativitas Siswa Sekolah Menengah. Jakarta: Gramedia Pustaka Utama. Sikki, E. A. A., Rahman, A., Hamra, A., & Noni, N. (2013). The Competence of Primary School English Teachers in Indonesia. Journal of Education and Practice, 4(11), 139–146. Siskandar. (2009). Kurikulum Berbasis Kompetensi. Jakarta: Fasilitator. Solchan, T. W., Mulyati, Y., Syarif, M., Yunus, M., Werdiningsih, E., Pramuki, B. E., & Setiawati, L. (2008). Pendidikan Bahasa Indonesia di SD. Jakarta. Jakarta: Universitas Terbuka. Solehudin, O. (2007). Model Pembelajaran Membaca Reading Workshop: Studi Kuasi Eksperimen di SD Muhammadiyah VII Bandung (Doctoral dissertation, Universitas Pendidikan Indonesia). Universitas Pendidikan Indonesia. Suparno, S., & Yunus, M. (2007). Keterampilan Dasar Menulis. Jakarta: Universitas Terbuka. Susanto, A. (2011). Perkembangan Anak Usia Dini Pengantar dalam Berbagai Aspeknya. Jakarta: Kencana Prenada Media Group. Suyanto, K. K. E. (2010). Teaching English as foreign language to young learners. Jakarta: State University of Malang. Tarigan, D. (2001). Pendidikan Bahasa dan sastra Indonesia Kelas Rendah. Jakarta: Universitas Terbuka. Trask, R. L., & Trask, R. L. (1996). Historical linguistics. New York: Oxford University Press. Ur, P. (1996). A course in Language Teaching. Practice and Theory. Cambridge: Cambridge. University Press. Williams, A. L., McLeod, S., & McCauley, R. J. (2010). Interventions for Speech Sound Disorders in Children. Brookes Publishing Company.: PO Box 10624; Baltimore; MD 21285. Wright, P., Wallance, J., & McCAarthy, J. (2008). Aesthetics and experience-centered design. ACM Transactions on Computer-Human Interaction (TOCHI), 15(4), 18.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

[For the English abstract and full text of the article please see the attached PDF-File (English version follows Russian version)].ABSTRACT Historical analysis made by the author shows that the emergence of new t ransport communications contributes to creation of new major economic and cultural centers, while traditional centers, which turned away from traffic flows, lose their meaning. Research of transport conditions in pre-Columbian America (absence of wheel, horse-drawn, with the exception for the Central Andean region, and horse transport, a lower level of water communications development in comparison with the Old World) allows us to conclude that the lack of vehicles and the lack of private initiative in transport sector essentially limited the possibilities of social and economic growth in ancient civilizations. Keywords: transport, socio-economic development, communication lines, ancient civilization, economic history, institutions. REFERENCES 1. Mises, L. von. Socialism. Economic and Sociological Analysis [Ekonomicheskij i sociologicheskij analiz. Transl. from English]. Мoscow, Catallaxy publ., 1994, 416 p. 2. Goldstone, J. Why Europe? The Rise of the West in World History 1500-1850 [Pochemu Evropa? Vozvyshenie Zapada v mirovoj istorii, 1500-1850: Transl. from English]. Moscow, Izd-vo Instituta Gajdara publ., 2014, 224 p. 3. Ivanenko, A. F. Analysis of economic activity in the railway transport [Analiz hozjajstvennoj dejatel’nosti na zheleznodorozhnom transporte]. Moscow. Marshrut publ., 2004, 568 p. 4. Allen, R. C. Global Economic History: A Very Short Introduction [Global’naja ekonomicheskaja istoria: Kratkoe vvedenie: Transl. from English]. Moscow, Izd-vo Instituta Gajdara publ., 2013, 224 p. 5. Macheret, D. A. The impact of transport on socioeconomic development [Vlijanie transporta na social’noekonomicheskoe razvitie]. Ekonomika zheleznyh dorog, 2003, Iss. 10, pp. 16-19. 6. Macheret, D. A. Creation of Railway Network and Economic Growth. World of Transport and Transportation, 2011, Vol. 9, Iss. 1, pp. 164-169. 7. Macheret, D. A. Creation of Railway Network and Acceleration of Development of Russia. World of Transport and Transportation, 2012, Vol. 10, Iss. 4, pp. 184-192. 8. Lapidus, B. M., Macheret, D. A. Evolution of rail transport -on a way to an innovative renaissance [Evoljucia zheleznodorozhnogo transporta - na puti k innovacionnomu renessansu]. Vestnik VNIIZhT, 2011, Iss. 1, pp. 13-14. 9. Lapidus, B. M., Macheret, D. A. Macroeconomic aspects of evolution of rail transport [Makroekonomicheskij aspekt evolucii zheleznodorozhnogo transporta]. Voprosy ekonomiki, 2011, Iss. 3, pp. 124-137. 10. Macheret, D. A., Ryzhkov, A. V., Beloglazov, A. Yu., Zakharov, K. V. Macroeconomic assessment of transport infrastructure [Makroekonomicheskaja ocenka razvitija transportnoj infrastruktury]. Vestnik VNIIZhT, 2010, Iss. 5, pp. 3-10. 11. Fogel, R. W. Notes on the Social Saving Controversy. Journal of Economic History, Vol. 39, 1979, Iss. 1, pp. 1-55. 12. Fogel, R. W. Railroads and American Economic Growth: Essays in Econometric History. John Hopkins University Press, 1964, 296 р. 13. Macheret, D. A. Economic notes on domestic railways [Ekonomicheskie zapiski ob otechestvennyh zheleznyh dorogah]. Otechestvennye zapiski, 2013, Iss. 3, pp. 162-176. 14. Kapustina, A. V., Syrovatskaya, L. N., Chebykina, G. N. Veliky Ustyug [Velikij Ustug]. Vologda, Poligraf - Periodika publ., 2012, 96 p. 15. Attali, J. A Brief History of the Future [Kratkaja istoria budushhego. Transl. from English]. St. Petersburg, Piter publ., 2014, 288 p. 16. Macheret, D. A. Transport Factor in the Era of Ancient Civilizations. World of Transport and Transportation, 2014, Vol. 12, Iss. 2, pp. 230-241. 17. Macheret, D. A. Socio-Economic Role of Transport in the Middle Ages. World of Transport and Transportation, 2015, Vol. 13, Iss. 2, pp. 228-237. 18. Ponting, C. World History: A New Perspective [Vsemirnaja istoria. Novyj vzgljad: Transl. from English]. Moscow, AST; Astrel’ publ., 2010, 958 p. 19. Berezkin, Yu. E. The Incas. The historical experience of the empire [Inki. Istoricheskij opyt imperii]. Leningrad. Nauka publ., 1991, 230 p. 20. Ershova, G. G. Ancient America: a flight in time and space. Mesoamerica [Drevnjaja Amerika: polet vo vremeni i prostranstve. Mezoamerika]. Moscow. Aleteja publ., 2002, 392 p. 21. Bushnell, G. H. S. Peru: Ancient People and Places [Peru. Ot rannih ohotnikov do imperii inkov: Transl. from English]. Moscow, Centropoligraf publ., 2003, 190 p. 22. Macheret, D. A. Economy of Bottle Necks. World of Transport and Transportation, 2014, Vol. 12, Iss. 3, pp. 64-75. 23. Macheret, D. A. Time Multiplier in Transportation. World of Transport and Transportation, 2015, Vol. 13, Iss. 3, pp. 102-107. 24. Chernomordik, G. I., Kozin, B. S., Kozlov, I. T. On economic feasibility of loading level of single-track and double-track lines [Ob ekonomicheski celesoobraznom urovne zagruzki odnoputnyh i dvuhputnyh linij]. Transportnoe stroitel’stvo, 1960, Iss. 2, pp. 46-50. 25. Kozlov, V. E. Carrying capacity of railway lines and reliability of technical equipment [Propusknaja sposobnost’ zheleznodorozhnyh linij i nadezhnost’ tehnicheskih sredstv]. Vestnik VNIIZhT, 1979, Iss. 4, p. 16. 26. The concept of organization of heavy and long freight trains on the main directions of railway network [Koncepcia organizacii tjazhelovesnogo i dlinnosostavnogo dvizhenia gruzovyh poezdov na osnovnyh napravleniah seti zheleznyh dorog]. Ed. by Muginshtein, L. A. Moscow, VNIIZhT publ., 2007, 179 p. 27. Ershova, G. G. Ancient America: a flight in time and space. North America. South America [Drevnjaja Amerika: polet vo vremeni i prostranstve. Severnaja Amerika. Juzhnaja Amerika]. Moscow, Aleteya publ., 2002, 416 p. 28. Galich, M. History of pre-Columbian civilizations: Trans. from Spanish [Istoria dokolumbovyh civilizacij]. Moscow, Mysl’ publ., 1990, 407 p. 29. Stragis, Yu. P. History of Economics [Istoria ekonomiki]. Moscow, Velbi; Prospekt publ., 2007, 528 p. 30. Hagen, W. W. von. The Ancient Sun Kingdoms of the Americans [Acteki, majja, inki. Velikie carstva drevnej Ameriki: Transl. from English]. Moscow, Centrpoligraf publ., 2008, 539 p. 31. Gulyaev, V. I. Pre-Columbian sailing to America [Dokolumbovy plavanija v Ameriku]. Moscow. Lomonosov publ., 2010, 216 p. 32. World History: In 24 vol. - Vol.12. Start of colonial empires [Vsemirnaja istoria: V 24 t. - T.12. Nachalo kolonial’nyh imperij]. Minsk, Literatura publ., 1996, 592 p. 33. World History: In 24 vol. Vol.1 Stone Age [Vsemirnaja istoria: V 24 t. - T.1 Kamennyj vek]. Minsk, Literatura publ., 1997, 528 p. 34. Diamond, J. M. Collaps: How Societies Choose to Fail or Succeed [Kollaps. Pochemu odni obshhestva vyzhivajut, a drugie umirajut: Transl. from English]. Moscow, AST Moskva publ., 2010, 762 p. 35. Samarkina, I. K. Community in Peru: Essay on socio-economic development [Obshhina v Peru: Ocherk social’no-ekonomicheskogo razvitija]. Moscow, Nauka publ., 1974, 250 p.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Rapid urbanization rates impact significantly on the nature of Land Cover patterns of the environment, which has been evident in the depletion of vegetal reserves and in general modifying the human climatic systems (Henderson, et al., 2017; Kumar, Masago, Mishra, & f*ckushi, 2018; Luo and Lau, 2017). This study explores remote sensing classification technique and other auxiliary data to determine LULCC for a period of 50 years (1967-2016). The LULCC types identified were quantitatively evaluated using the change detection approach from results of maximum likelihood classification algorithm in GIS. Accuracy assessment results were evaluated and found to be between 56 to 98 percent of the LULC classification. The change detection analysis revealed change in the LULC types in Minna from 1976 to 2016. Built-up area increases from 74.82ha in 1976 to 116.58ha in 2016. Farmlands increased from 2.23 ha to 46.45ha and bared surface increases from 120.00ha to 161.31ha between 1976 to 2016 resulting to decline in vegetation, water body, and wetlands. The Decade of rapid urbanization was found to coincide with the period of increased Public Private Partnership Agreement (PPPA). Increase in farmlands was due to the adoption of urban agriculture which has influence on food security and the environmental sustainability. The observed increase in built up areas, farmlands and bare surfaces has substantially led to reduction in vegetation and water bodies. The oscillatory nature of water bodies LULCC which was not particularly consistent with the rates of urbanization also suggests that beyond the urbanization process, other factors may influence the LULCC of water bodies in urban settlements. Keywords: Minna, Niger State, Remote Sensing, Land Surface Characteristics References Akinrinmade, A., Ibrahim, K., & Abdurrahman, A. (2012). Geological Investigation of Tagwai Dams using Remote Sensing Technique, Minna Niger State, Nigeria. Journal of Environment, 1(01), pp. 26-32. Amadi, A., & Olasehinde, P. (2010). Application of remote sensing techniques in hydrogeological mapping of parts of Bosso Area, Minna, North-Central Nigeria. International Journal of Physical Sciences, 5(9), pp. 1465-1474. Aplin, P., & Smith, G. (2008). Advances in object-based image classification. The International Archives of the Photogrammetry, Remote Sensing and Spatial Information Sciences, 37(B7), pp. 725-728. Ayele, G. T., Tebeje, A. K., Demissie, S. S., Belete, M. A., Jemberrie, M. A., Teshome, W. M., . . . Teshale, E. Z. (2018). Time Series Land Cover Mapping and Change Detection Analysis Using Geographic Information System and Remote Sensing, Northern Ethiopia. Air, Soil and Water Research, 11, p 1178622117751603. Azevedo, J. A., Chapman, L., & Muller, C. L. (2016). Quantifying the daytime and night-time urban heat island in Birmingham, UK: a comparison of satellite derived land surface temperature and high resolution air temperature observations. Remote Sensing, 8(2), p 153. Blaschke, T., Hay, G. J., Kelly, M., Lang, S., Hofmann, P., Addink, E., . . . van Coillie, F. (2014). Geographic object-based image analysis–towards a new paradigm. ISPRS Journal of Photogrammetry and Remote Sensing, 87, pp. 180-191. Bukata, R. P., Jerome, J. H., Kondratyev, A. S., & Pozdnyakov, D. V. (2018). Optical properties and remote sensing of inland and coastal waters: CRC press. Camps-Valls, G., Tuia, D., Bruzzone, L., & Benediktsson, J. A. (2014). Advances in hyperspectral image classification: Earth monitoring with statistical learning methods. IEEE signal processing magazine, 31(1), pp. 45-54. Chen, J., Chen, J., Liao, A., Cao, X., Chen, L., Chen, X., . . . Lu, M. (2015). Global land cover mapping at 30 m resolution: A POK-based operational approach. ISPRS Journal of Photogrammetry and Remote Sensing, 103, pp. 7-27. Chen, M., Mao, S., & Liu, Y. (2014). Big data: A survey. Mobile networks and applications, 19(2), pp. 171-209. Cheng, G., Han, J., Guo, L., Liu, Z., Bu, S., & Ren, J. (2015). Effective and efficient midlevel visual elements-oriented land-use classification using VHR remote sensing images. IEEE transactions on geoscience and remote sensing, 53(8), pp. 4238-4249. Cheng, G., Han, J., Zhou, P., & Guo, L. (2014). Multi-class geospatial object detection and geographic image classification based on collection of part detectors. ISPRS Journal of Photogrammetry and Remote Sensing, 98, pp. 119-132. Coale, A. J., & Hoover, E. M. (2015). Population growth and economic development: Princeton University Press. Congalton, R. G., & Green, K. (2008). Assessing the accuracy of remotely sensed data: principles and practices: CRC press. Corner, R. J., Dewan, A. M., & Chakma, S. (2014). Monitoring and prediction of land-use and land-cover (LULC) change Dhaka megacity (pp. 75-97): Springer. Coutts, A. M., Harris, R. J., Phan, T., Livesley, S. J., Williams, N. S., & Tapper, N. J. (2016). Thermal infrared remote sensing of urban heat: Hotspots, vegetation, and an assessment of techniques for use in urban planning. Remote Sensing of Environment, 186, pp. 637-651. Debnath, A., Debnath, J., Ahmed, I., & Pan, N. D. (2017). Change detection in Land use/cover of a hilly area by Remote Sensing and GIS technique: A study on Tropical forest hill range, Baramura, Tripura, Northeast India. International journal of geomatics and geosciences, 7(3), pp. 293-309. Desheng, L., & Xia, F. (2010). Assessing object-based classification: advantages and limitations. Remote Sensing Letters, 1(4), pp. 187-194. Dewan, A. M., & Yamaguchi, Y. (2009). Land use and land cover change in Greater Dhaka, Bangladesh: Using remote sensing to promote sustainable urbanization. Applied Geography, 29(3), pp. 390-401. Dronova, I., Gong, P., Wang, L., & Zhong, L. (2015). Mapping dynamic cover types in a large seasonally flooded wetland using extended principal component analysis and object-based classification. Remote Sensing of Environment, 158, pp. 193-206. Duro, D. C., Franklin, S. E., & Dubé, M. G. (2012). A comparison of pixel-based and object-based image analysis with selected machine learning algorithms for the classification of agricultural landscapes using SPOT-5 HRG imagery. Remote Sensing of Environment, 118, pp. 259-272. Elmhagen, B., Destouni, G., Angerbjörn, A., Borgström, S., Boyd, E., Cousins, S., . . . Hambäck, P. (2015). Interacting effects of change in climate, human population, land use, and water use on biodiversity and ecosystem services. Ecology and Society, 20(1) Farhani, S., & Ozturk, I. (2015). Causal relationship between CO 2 emissions, real GDP, energy consumption, financial development, trade openness, and urbanization in Tunisia. Environmental Science and Pollution Research, 22(20), pp. 15663-15676. Feng, L., Chen, B., Hayat, T., Alsaedi, A., & Ahmad, B. (2017). The driving force of water footprint under the rapid urbanization process: a structural decomposition analysis for Zhangye city in China. Journal of Cleaner Production, 163, pp. S322-S328. Fensham, R., & Fairfax, R. (2002). Aerial photography for assessing vegetation change: a review of applications and the relevance of findings for Australian vegetation history. Australian Journal of Botany, 50(4), pp. 415-429. Ferreira, N., Lage, M., Doraiswamy, H., Vo, H., Wilson, L., Werner, H., . . . Silva, C. (2015). Urbane: A 3d framework to support data driven decision making in urban development. Visual Analytics Science and Technology (VAST), 2015 IEEE Conference on. Garschagen, M., & Romero-Lankao, P. (2015). Exploring the relationships between urbanization trends and climate change vulnerability. Climatic Change, 133(1), pp. 37-52. Gokturk, S. B., Sumengen, B., Vu, D., Dalal, N., Yang, D., Lin, X., . . . Torresani, L. (2015). System and method for search portions of objects in images and features thereof: Google Patents. Government, N. S. (2007). Niger state (The Power State). Retrieved from http://nigerstate.blogspot.com.ng/ Green, K., Kempka, D., & Lackey, L. (1994). Using remote sensing to detect and monitor land-cover and land-use change. Photogrammetric engineering and remote sensing, 60(3), pp. 331-337. Gu, W., Lv, Z., & Hao, M. (2017). Change detection method for remote sensing images based on an improved Markov random field. Multimedia Tools and Applications, 76(17), pp. 17719-17734. Guo, Y., & Shen, Y. (2015). Quantifying water and energy budgets and the impacts of climatic and human factors in the Haihe River Basin, China: 2. Trends and implications to water resources. Journal of Hydrology, 527, pp. 251-261. Hadi, F., Thapa, R. B., Helmi, M., Hazarika, M. K., Madawalagama, S., Deshapriya, L. N., & Center, G. (2016). Urban growth and land use/land cover modeling in Semarang, Central Java, Indonesia: Colombo-Srilanka, ACRS2016. Hagolle, O., Huc, M., Villa Pascual, D., & Dedieu, G. (2015). A multi-temporal and multi-spectral method to estimate aerosol optical thickness over land, for the atmospheric correction of FormoSat-2, LandSat, VENμS and Sentinel-2 images. Remote Sensing, 7(3), pp. 2668-2691. Hegazy, I. R., & Kaloop, M. R. (2015). Monitoring urban growth and land use change detection with GIS and remote sensing techniques in Daqahlia governorate Egypt. International Journal of Sustainable Built Environment, 4(1), pp. 117-124. Henderson, J. V., Storeygard, A., & Deichmann, U. (2017). Has climate change driven urbanization in Africa? Journal of development economics, 124, pp. 60-82. Hu, L., & Brunsell, N. A. (2015). A new perspective to assess the urban heat island through remotely sensed atmospheric profiles. Remote Sensing of Environment, 158, pp. 393-406. Hughes, S. J., Cabral, J. A., Bastos, R., Cortes, R., Vicente, J., Eitelberg, D., . . . Santos, M. (2016). A stochastic dynamic model to assess land use change scenarios on the ecological status of fluvial water bodies under the Water Framework Directive. Science of the Total Environment, 565, pp. 427-439. Hussain, M., Chen, D., Cheng, A., Wei, H., & Stanley, D. (2013). Change detection from remotely sensed images: From pixel-based to object-based approaches. ISPRS Journal of Photogrammetry and Remote Sensing, 80, pp. 91-106. Hyyppä, J., Hyyppä, H., Inkinen, M., Engdahl, M., Linko, S., & Zhu, Y.-H. (2000). Accuracy comparison of various remote sensing data sources in the retrieval of forest stand attributes. Forest Ecology and Management, 128(1-2), pp. 109-120. Jiang, L., Wu, F., Liu, Y., & Deng, X. (2014). Modeling the impacts of urbanization and industrial transformation on water resources in China: an integrated hydro-economic CGE analysis. Sustainability, 6(11), pp. 7586-7600. Jin, S., Yang, L., Zhu, Z., & Homer, C. (2017). A land cover change detection and classification protocol for updating Alaska NLCD 2001 to 2011. Remote Sensing of Environment, 195, pp. 44-55. Joshi, N., Baumann, M., Ehammer, A., Fensholt, R., Grogan, K., Hostert, P., . . . Mitchard, E. T. (2016). A review of the application of optical and radar remote sensing data fusion to land use mapping and monitoring. Remote Sensing, 8(1), p 70. Kaliraj, S., Chandrasekar, N., & Magesh, N. (2015). Evaluation of multiple environmental factors for site-specific groundwater recharge structures in the Vaigai River upper basin, Tamil Nadu, India, using GIS-based weighted overlay analysis. Environmental earth sciences, 74(5), pp. 4355-4380. Koop, S. H., & van Leeuwen, C. J. (2015). Assessment of the sustainability of water resources management: A critical review of the City Blueprint approach. Water Resources Management, 29(15), pp. 5649-5670. Kumar, P., Masago, Y., Mishra, B. K., & f*ckushi, K. (2018). Evaluating future stress due to combined effect of climate change and rapid urbanization for Pasig-Marikina River, Manila. Groundwater for Sustainable Development, 6, pp. 227-234. Lang, S. (2008). Object-based image analysis for remote sensing applications: modeling reality–dealing with complexity Object-based image analysis (pp. 3-27): Springer. Li, M., Zang, S., Zhang, B., Li, S., & Wu, C. (2014). A review of remote sensing image classification techniques: The role of spatio-contextual information. European Journal of Remote Sensing, 47(1), pp. 389-411. Liddle, B. (2014). Impact of population, age structure, and urbanization on carbon emissions/energy consumption: evidence from macro-level, cross-country analyses. Population and Environment, 35(3), pp. 286-304. Lillesand, T., Kiefer, R. W., & Chipman, J. (2014). Remote sensing and image interpretation: John Wiley & Sons. Liu, Y., Wang, Y., Peng, J., Du, Y., Liu, X., Li, S., & Zhang, D. (2015). Correlations between urbanization and vegetation degradation across the world’s metropolises using DMSP/OLS nighttime light data. Remote Sensing, 7(2), pp. 2067-2088. López, E., Bocco, G., Mendoza, M., & Duhau, E. (2001). Predicting land-cover and land-use change in the urban fringe: a case in Morelia city, Mexico. Landscape and urban planning, 55(4), pp. 271-285. Luo, M., & Lau, N.-C. (2017). Heat waves in southern China: Synoptic behavior, long-term change, and urbanization effects. Journal of Climate, 30(2), pp. 703-720. Mahboob, M. A., Atif, I., & Iqbal, J. (2015). Remote sensing and GIS applications for assessment of urban sprawl in Karachi, Pakistan. Science, Technology and Development, 34(3), pp. 179-188. Mallinis, G., Koutsias, N., Tsakiri-Strati, M., & Karteris, M. (2008). Object-based classification using Quickbird imagery for delineating forest vegetation polygons in a Mediterranean test site. ISPRS Journal of Photogrammetry and Remote Sensing, 63(2), pp. 237-250. Mas, J.-F., Velázquez, A., Díaz-Gallegos, J. R., Mayorga-Saucedo, R., Alcántara, C., Bocco, G., . . . Pérez-Vega, A. (2004). Assessing land use/cover changes: a nationwide multidate spatial database for Mexico. International Journal of Applied Earth Observation and Geoinformation, 5(4), pp. 249-261. Mathew, A., Chaudhary, R., Gupta, N., Khandelwal, S., & Kaul, N. (2015). Study of Urban Heat Island Effect on Ahmedabad City and Its Relationship with Urbanization and Vegetation Parameters. International Journal of Computer & Mathematical Science, 4, pp. 2347-2357. Megahed, Y., Cabral, P., Silva, J., & Caetano, M. (2015). Land cover mapping analysis and urban growth modelling using remote sensing techniques in greater Cairo region—Egypt. ISPRS International Journal of Geo-Information, 4(3), pp. 1750-1769. Metternicht, G. (2001). Assessing temporal and spatial changes of salinity using fuzzy logic, remote sensing and GIS. Foundations of an expert system. Ecological modelling, 144(2-3), pp. 163-179. Miller, R. B., & Small, C. (2003). Cities from space: potential applications of remote sensing in urban environmental research and policy. Environmental Science & Policy, 6(2), pp. 129-137. Mirzaei, P. A. (2015). Recent challenges in modeling of urban heat island. Sustainable Cities and Society, 19, pp. 200-206. Mohammed, I., Aboh, H., & Emenike, E. (2007). A regional geoelectric investigation for groundwater exploration in Minna area, north west Nigeria. Science World Journal, 2(4) Morenikeji, G., Umaru, E., Liman, S., & Ajagbe, M. (2015). Application of Remote Sensing and Geographic Information System in Monitoring the Dynamics of Landuse in Minna, Nigeria. International Journal of Academic Research in Business and Social Sciences, 5(6), pp. 320-337. Mukherjee, A. B., Krishna, A. P., & Patel, N. (2018). Application of Remote Sensing Technology, GIS and AHP-TOPSIS Model to Quantify Urban Landscape Vulnerability to Land Use Transformation Information and Communication Technology for Sustainable Development (pp. 31-40): Springer. Myint, S. W., Gober, P., Brazel, A., Grossman-Clarke, S., & Weng, Q. (2011). Per-pixel vs. object-based classification of urban land cover extraction using high spatial resolution imagery. Remote Sensing of Environment, 115(5), pp. 1145-1161. Nemmour, H., & Chibani, Y. (2006). Multiple support vector machines for land cover change detection: An application for mapping urban extensions. ISPRS Journal of Photogrammetry and Remote Sensing, 61(2), pp. 125-133. Niu, X., & Ban, Y. (2013). Multi-temporal RADARSAT-2 polarimetric SAR data for urban land-cover classification using an object-based support vector machine and a rule-based approach. International journal of remote sensing, 34(1), pp. 1-26. Nogueira, K., Penatti, O. A., & dos Santos, J. A. (2017). Towards better exploiting convolutional neural networks for remote sensing scene classification. Pattern Recognition, 61, pp. 539-556. Oguz, H., & Zengin, M. (2011). Analyzing land use/land cover change using remote sensing data and landscape structure metrics: a case study of Erzurum, Turkey. Fresenius Environmental Bulletin, 20(12), pp. 3258-3269. Pohl, C., & Van Genderen, J. L. (1998). Review article multisensor image fusion in remote sensing: concepts, methods and applications. International journal of remote sensing, 19(5), pp. 823-854. Price, O., & Bradstock, R. (2014). Countervailing effects of urbanization and vegetation extent on fire frequency on the Wildland Urban Interface: Disentangling fuel and ignition effects. Landscape and urban planning, 130, pp. 81-88. Prosdocimi, I., Kjeldsen, T., & Miller, J. (2015). Detection and attribution of urbanization effect on flood extremes using nonstationary flood‐frequency models. Water resources research, 51(6), pp. 4244-4262. Rawat, J., & Kumar, M. (2015). Monitoring land use/cover change using remote sensing and GIS techniques: A case study of Hawalbagh block, district Almora, Uttarakhand, India. The Egyptian Journal of Remote Sensing and Space Science, 18(1), pp. 77-84. Rokni, K., Ahmad, A., Solaimani, K., & Hazini, S. (2015). A new approach for surface water change detection: Integration of pixel level image fusion and image classification techniques. International Journal of Applied Earth Observation and Geoinformation, 34, pp. 226-234. Sakieh, Y., Amiri, B. J., Danekar, A., Feghhi, J., & Dezhkam, S. (2015). Simulating urban expansion and scenario prediction using a cellular automata urban growth model, SLEUTH, through a case study of Karaj City, Iran. Journal of Housing and the Built Environment, 30(4), pp. 591-611. Santra, A. (2016). Land Surface Temperature Estimation and Urban Heat Island Detection: A Remote Sensing Perspective. Remote Sensing Techniques and GIS Applications in Earth and Environmental Studies, p 16. Shrivastava, L., & Nag, S. (2017). MONITORING OF LAND USE/LAND COVER CHANGE USING GIS AND REMOTE SENSING TECHNIQUES: A CASE STUDY OF SAGAR RIVER WATERSHED, TRIBUTARY OF WAINGANGA RIVER OF MADHYA PRADESH, INDIA. Shuaibu, M., & Sulaiman, I. (2012). Application of remote sensing and GIS in land cover change detection in Mubi, Adamawa State, Nigeria. J Technol Educ Res, 5, pp. 43-55. Song, B., Li, J., Dalla Mura, M., Li, P., Plaza, A., Bioucas-Dias, J. M., . . . Chanussot, J. (2014). Remotely sensed image classification using sparse representations of morphological attribute profiles. IEEE transactions on geoscience and remote sensing, 52(8), pp. 5122-5136. Song, X.-P., Sexton, J. O., Huang, C., Channan, S., & Townshend, J. R. (2016). Characterizing the magnitude, timing and duration of urban growth from time series of Landsat-based estimates of impervious cover. Remote Sensing of Environment, 175, pp. 1-13. Tayyebi, A., Shafizadeh-Moghadam, H., & Tayyebi, A. H. (2018). Analyzing long-term spatio-temporal patterns of land surface temperature in response to rapid urbanization in the mega-city of Tehran. Land Use Policy, 71, pp. 459-469. Teodoro, A. C., Gutierres, F., Gomes, P., & Rocha, J. (2018). Remote Sensing Data and Image Classification Algorithms in the Identification of Beach Patterns Beach Management Tools-Concepts, Methodologies and Case Studies (pp. 579-587): Springer. Toth, C., & Jóźków, G. (2016). Remote sensing platforms and sensors: A survey. ISPRS Journal of Photogrammetry and Remote Sensing, 115, pp. 22-36. Tuholske, C., Tane, Z., López-Carr, D., Roberts, D., & Cassels, S. (2017). Thirty years of land use/cover change in the Caribbean: Assessing the relationship between urbanization and mangrove loss in Roatán, Honduras. Applied Geography, 88, pp. 84-93. Tuia, D., Flamary, R., & Courty, N. (2015). Multiclass feature learning for hyperspectral image classification: Sparse and hierarchical solutions. ISPRS Journal of Photogrammetry and Remote Sensing, 105, pp. 272-285. Tzotsos, A., & Argialas, D. (2008). Support vector machine classification for object-based image analysis Object-Based Image Analysis (pp. 663-677): Springer. Wang, L., Sousa, W., & Gong, P. (2004). Integration of object-based and pixel-based classification for mapping mangroves with IKONOS imagery. International journal of remote sensing, 25(24), pp. 5655-5668. Wang, Q., Zeng, Y.-e., & Wu, B.-w. (2016). Exploring the relationship between urbanization, energy consumption, and CO2 emissions in different provinces of China. Renewable and Sustainable Energy Reviews, 54, pp. 1563-1579. Wang, S., Ma, H., & Zhao, Y. (2014). Exploring the relationship between urbanization and the eco-environment—A case study of Beijing–Tianjin–Hebei region. Ecological Indicators, 45, pp. 171-183. Weitkamp, C. (2006). Lidar: range-resolved optical remote sensing of the atmosphere: Springer Science & Business. Wellmann, T., Haase, D., Knapp, S., Salbach, C., Selsam, P., & Lausch, A. (2018). Urban land use intensity assessment: The potential of spatio-temporal spectral traits with remote sensing. Ecological Indicators, 85, pp. 190-203. Whiteside, T. G., Boggs, G. S., & Maier, S. W. (2011). Comparing object-based and pixel-based classifications for mapping savannas. International Journal of Applied Earth Observation and Geoinformation, 13(6), pp. 884-893. Willhauck, G., Schneider, T., De Kok, R., & Ammer, U. (2000). Comparison of object oriented classification techniques and standard image analysis for the use of change detection between SPOT multispectral satellite images and aerial photos. Proceedings of XIX ISPRS congress. Winker, D. M., Vaughan, M. A., Omar, A., Hu, Y., Powell, K. A., Liu, Z., . . . Young, S. A. (2009). Overview of the CALIPSO mission and CALIOP data processing algorithms. Journal of Atmospheric and Oceanic Technology, 26(11), pp. 2310-2323. Yengoh, G. T., Dent, D., Olsson, L., Tengberg, A. E., & Tucker III, C. J. (2015). Use of the Normalized Difference Vegetation Index (NDVI) to Assess Land Degradation at Multiple Scales: Current Status, Future Trends, and Practical Considerations: Springer. Yu, Q., Gong, P., Clinton, N., Biging, G., Kelly, M., & Schirokauer, D. (2006). Object-based detailed vegetation classification with airborne high spatial resolution remote sensing imagery. Photogrammetric Engineering & Remote Sensing, 72(7), pp. 799-811. Zhou, D., Zhao, S., Zhang, L., & Liu, S. (2016). Remotely sensed assessment of urbanization effects on vegetation phenology in China's 32 major cities. Remote Sensing of Environment, 176, pp. 272-281. Zhu, Z., Fu, Y., Woodco*ck, C. E., Olofsson, P., Vogelmann, J. E., Holden, C., . . . Yu, Y. (2016). Including land cover change in analysis of greenness trends using all available Landsat 5, 7, and 8 images: A case study from Guangzhou, China (2000–2014). Remote Sensing of Environment, 185, pp. 243-257.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

-Stanley L. Engerman, B.W. Higman, Slave populations of the British Caribbean, 1807-1834. Baltimore: The Johns Hopkins University Press, Johns Hopkins Studies in Atlantic History and Culture, 1984. xxxiii + 781 pp.-Susan Lowes, Gad J. Heuman, Between black and white: race, politics, and the free coloureds in Jamaica, 1792-1865. Westport CT: Greenwood Press, Contributions in Comparative Colonial Studies No. 5, 1981. 20 + 321 pp.-Anthony Payne, Lester D. Langley, The banana wars: an inner history of American empire, 1900-1934. Lexington KY: University Press of Kentucky, 1983. VIII + 255 pp.-Roger N. Buckley, David Geggus, Slavery, war and revolution: the British occupation of Saint Domingue, 1793-1798. New York: The Clarendon Press, Oxford University Press, 1982. xli + 492 pp.-Gabriel Debien, George Breathett, The Catholic Church in Haiti (1704-1785): selected letters, memoirs and documents. Chapel Hill NC: Documentary Publications, 1983. xii + 202 pp.-Alex Stepick, Michel S. Laguerre, American Odyssey: Haitians in New York City. Ithaca and London: Cornell University Press, 1984. 198 pp-Andres Serbin, H. Michael Erisman, The Caribbean challenge: U.S. policy in a volatile region. Boulder CO: Westview Press, 1984. xiii + 208 pp.-Andres Serbin, Ransford W. Palmer, Problems of development in beautiful countries: perspectives on the Caribbean. Lanham MD: The North-South Publishing Company, 1984. xvii + 91 pp.-Carl Stone, Anthony Payne, The politics of the Caribbean community 1961-79: regional integration among new states. Oxford: Manchester University Press, 1980. xi + 299 pp.-Evelyne Huber Stephens, Michael Manley, Jamaica: struggle in the periphery. London: Third World Media, in association with Writers and Readers Publishing Cooperative Society, 1982. xi + 259 pp.-Rhoda Reddock, Epica Task Force, Grenada: the peaceful revolution. Washington D.C., 1982. 132 pp.-Rhoda Reddock, W. Richard Jacobs ,Grenada: the route to revolution. Havana: Casa de Las Americas, 1979. 157 pp., Ian Jacobs (eds)-Jacqueline Anne Braveboy-Wagner, Andres Serbin, Geopolitica de las relaciones de Venezuela con el Caribe. Caracas: Fundación Fondo Editorial Acta Cientifica Venezolana, 1983.-Idsa E. Alegria-Ortega, Jorge Heine, Time for decision: the United States and Puerto Rico. Lanham MD: North-South Publishing Co., 1983. xi + 303 pp.-Richard Hart, Edward A. Alpers ,Walter Rodney, revolutionary and scholar: a tribute. Los Angeles: Center for Afro-American Studies and African Studies Center, University of California, 1982. xi + 187 pp., Pierre-Michel Fontaine (eds)-Paul Sutton, Patrick Solomon, Solomon: an autobiography. Trinidad: Inprint Caribbean, 1981. x + 253 pp.-Paul Sutton, Selwyn R. Cudjoe, Movement of the people: essays on independence. Ithaca NY: Calaloux Publications, 1983. xii + 217 pp.-David Barry Gaspar, Richard Price, To slay the Hydra: Dutch colonial perspectives on the Saramaka wars. Ann Arbor MI: Karoma Publishers, 1983. 249 pp.-Gary Brana-Shute, R. van Lier, Bonuman: een studie van zeven religieuze specialisten in Suriname. Leiden: Institute of Cultural and Social Studies, ICA Publication no. 60, 1983. iii + 132 pp.-W. van Wetering, Charles J. Wooding, Evolving culture: a cross-cultural study of Suriname, West Africa and the Caribbean. Washington: University Press of America 1981. 343 pp.-Humphrey E. Lamur, Sergio Diaz-Briquets, The health revolution in Cuba. Austin: University of Texas Press, 1983. xvii + 227 pp.-Forrest D. Colburn, Ramesh F. Ramsaran, The monetary and financial system of the Bahamas: growth, structure and operation. Mona, Jamaica: Institute of Social and Economic Research, University of the West Indies, 1984. xiii + 409 pp.-Wim Statius Muller, A.M.G. Rutten, Leven en werken van de dichter-musicus J.S. Corsen. Assen, The Netherlands: Van Gorcum, 1983. xiv + 340 pp.-Louis Allaire, Ricardo E. Alegria, Ball courts and ceremonial plazas in the West Indies. New Haven: Department of Anthropology of Yale University, Yale University Publications in Anthropology No. 79, 1983. lx + 185 pp.-Kenneth Ramchand, Sandra Paquet, The Novels of George Lamming. London: Heinemann, 1982. 132 pp.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Gulf licaria, Licaria trianda (Sw.) Kosterm., is a federally endangered member of the Lauraceae plant family in Miami-Dade County, Florida. It was never common in the area, and urban development has extirpated it from most of its former range; as of 2001, fewer than 10 trees remained in a single, remnant habitat in the continental United States, Simpson Park (25°45′31″N, 80°11′46″W) (2). Laurel wilt, caused by the fungus Raffaelea lauricola T. C. Harr., Fraedrich & Aghayeva, has recently devastated members of the Lauraceae in the southeastern United States, most notably redbay, Persea borbonia (1). As R. lauricola and its vector, the redbay ambrosia beetle Xyleborus glabratus, have spread in the region, an increasing number of taxa in this plant family have been affected by this disease (1). In 2012, seedlings of gulf licaria and redbay were obtained from local nurseries; they were grown in 30 liter pots, 1.3 m tall, had stems 3 cm in diameter 20 cm above the soil line, and were maintained with standard watering and fertilization practices. In two pathogenicity experiments on July 6 and September 25, 2012, three plants each of gulf licaria and redbay were inoculated with an isolate of R. lauricola, RL4, as described in previous experiments (3), and two plants each were mock inoculated (water control). RL4 is deposited as CBS 127349 at the Centraalbureau voor Schimmelcultures (CBS Fungal Biodiversity Centre, Utrecht, The Netherlands), and a SSU rDNA sequence for it is deposited in GenBank under Accession No. HM446155. Beginning 2 weeks after inoculation, plants were rated on a weekly basis for the development of external symptoms, on a subjective 1 (no symptoms) to 10 (dead) scale (3). After 5 weeks, inoculated plants of redbay in each experiment (positive control) had died after first developing symptoms of wilt and necrotic foliage that are typical for this disease (1). In contrast, inoculated plants of gulf licaria developed severe symptoms by the time experiments were terminated 6 and 11 weeks after inoculation; chlorosis developed on some of the leaves of all plants and these eventually abscised (mean external severities of 7.3 and 6.5, respectively), but plants did not die. Brown to greyish discoloration of sapwood developed in all inoculated plants, and the pathogen was recovered from symptomatic sapwood on CSMA (3). No symptoms developed on mock inoculated plants and the pathogen was not recovered from them. It is concluded that gulf licaria is susceptible to laurel wilt, but that it is apparently less susceptible than redbay. Whether X. glabratus is attracted to, or will bore into, gulf licaria is not known, but will play a significant role in the extent to which this rare tree is affected by laurel wilt. References: (1) S. W. Fraedrich et al. Plant Dis. 92:215, 2008. (2) G. D. Gann et al. Rare Plants of South Florida: Their History, Conservation, and Restoration. Institute for Regional Conservation, Miami, 2002. (3) R. C. Ploetz et al. Plant Pathol. 61:801, 2012.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Study of petrological and geochemical characteristics of mantle peridotite xenoliths in Pliocene alkaline basalt in Nghia Dan (West Nghe An) was carried out. Rock-forming clinopyroxenes, the major trace element containers, were separated from the xenoliths to analyze for major, trace element and Sr-Nd isotopic compositions. The data were interpreted for source geochemical characteristics and geodynamic processes of the lithospheric mantle beneath the region. The peridotite xenoliths being mostly spinel-lherzolites in composition, are residual entities having been produced following partial melting events of ultramafic rocks in the asthenosphere. They are depleted in trace element abundance and Sr-Nd isotopic composition. Some are even more depleted as compared to mid-ocean ridge mantle xenoliths. Modelled calculation based on trace element abundances and their corresponding solid/liquid distribution coefficients showed that the Nghia Dan mantle xenoliths may be produced of melting degrees from 8 to 12%. Applying various methods for two-pyroxene temperature- pressure estimates, the Nghia Dan mantle xenoliths show ranges of crystallization temperature and pressure, respectively, of 1010-1044°C and 13-14.2 kbar, roughly about 43km. A geotherm constructed for the mantle xenoliths showed a higher geothermal gradient as compared to that of in the western Highlands (Vietnam) and a conductive model, implying a thermal perturbation under the region. The calculated Sm-Nd model ages for the clinopyroxenes yielded 127 and 122 Ma. If the age is meaningful it suggests that there was a major geodynamic process occurred beneath Western Nghe An in the middle- Early Cretaceous that was large enough to cause perturbation in the evolutional trend of the Sm-Nd isotopic system.ReferencesAn A-R., Choi S.H., Yu Y-g., Lee D-C., 2017. Petrogenesis of Late Cenozoic basaltic rocks from southern Vietnam. Lithos, 272-273 (2017), 192-204.Anders E., Grevesse N., 1989. Abundances of the elements: meteorite and solar. Geochimica et Cosmochimica Acta, 53, 197-214.Anderson D.L, 1994. The subcontinental mantle as the source of continental flood basalts; the case against the continental lithosphere mantle and plume hear reservoirs. Earth and Planetary Science Letter, 123, 269-280.Arai S., 1994. Characterization of spinel peridotites by olivine-spinel compositional relationships: review and interpretation. Chemical Geology, 113, 191-204.Ballhaus C., Berry R.G., Green D.H., 1991. High pressure experimental calibration of the olivine orthopyroxene-spinel oxygen geobarometer: implications for the oxidation state of the upper mantle. Contributions to Mineralogy and Petrology, 107, 27-40.Barr S.M. and MacDonald A.S., 1981. Geochemistry and geochronology of late Cenozoic basalts of southeast Asia: summary. Geological Society of America Bulletin, 92, 508-512.Brey G.P., Köhler T., 1990. Geothermobarometry in four-phase lherzolite II. New thermobarometers, and practical assessment of existing thermobarometers. Journal of Petrology, 31, 1353-1378.Briais A., Patriat P., Tapponnier P., 1993. Updated interpretation of magnetic anomalies and seafloor spreading stages in the South China Sea, implications for the Tertiary tectonics of SE Asia. Journal of Geophysical Research, 98, 6299-6328.Carlson R.W., Irving A.J., 1994. Depletion and enrichment history of subcontinental lithospheric mantle: an Os, Sr, Nd and Pb isotopic study of ultramafic xenoliths from the northwestern Wyoming Craton. Earth and Planetary Science Letters, 126, 457-472.Carlson R.W., Lugmair G.W., 1979. Sm-Nd constraints on early lunar differentiation and the evolution of KREEP. Earth and Planetary Science Letters, 45, 123-132.Carlson R.W., Lugmair G.W., 1981. Sm-Nd age of lherzolite 67667: implications for the processes involved in lunar crustal formation. Earth and Planetary Science Letters, 56, 1-8.Choi H.S., Mukasa S.B., Zhou X-H., Xian X-G.H., Andronikov A.V., 2008. Mantle dynamics beneath East Asia constrained by Sr, Nd, Pb and Hf isotopic systematics of ultramafic xenoliths and their host basalts from Hannuoba, North China. Chemical Geology, 248, 40-61.Choi S.H., Jwa Y.-J., Lee H.Y., 2001. Geothermal gradient of the upper mantle beneath Jeju Island, Korea: evidence from mantle xenoliths. Island Arc, 10, 175-193.Choi S.H., Kwon S-T., Mukasa S.B., Sagon H., 2005. Sr-Nd-Pb isotope and trace element systematics of mantle xenoliths from Late Cenozoic alkaline lavas, South Korea. Chemical Geology, 22, 40-64.Cox K.G., Bell J.D., Pankhurst R.J., 1979. The Interpretation of Igneous Rocks. George Allen & Unwin.Cung Thuong Chi, Dorobek S.L., Richter C., Flower M., Kikawa E., Nguyen Y.T., McCabe R., 1998. Paleomagnetism of Late Neogene basalts in Vietnam and Thailand: Implications for the Post-Miocene tectonic history of Indochina. In: Flower M.F.J., Chung, S.L., Lo, C.H., (Eds.). Mantle Dynamics and Plate Interactions in East Asia. Geodynamics Ser, American Geophysical Union, 27, 289-299.De Hoog J.C.M., Gall L., Cornell D.H., 2010. Trace-element geochemistry of mantle olivine and application to mantle petrogenesis and geothermobarometry. Chemical Geology, 270, 196-215.DePaolo D. J., 1981. Neodymium isotopes in the Colorado Front Range and crust - mantle evolution in the Proterozoic. Nature, 291, 193-197.DePaolo D.J., Wasserburg G.J., 1976. Nd isotopic variations and petrogenetic models. Geophysical Research Letters, 3(5), 249-252. Doi: https://doi.org/10.2113/gselements.13.1.11.Embey-Isztin A., Dobosi G., Meyer H.-P., 2001. Thermal evolution of the lithosphere beneath the western Pannonian Basin: evidence from deep-seat xenoliths. Tectonophysics, 331, 285-306.Fedorov P.I., Koloskov A.V., 2005. Cenozoic volcanism of Southeast Asia. Petrologiya, 13(4), 289-420.Frey F.A., Prinz M., 1978. Ultramafic inclusions from San Carlos, Arizona: Petrologic and geochemical data bearing on their Petrogenesis. Earth and Planetary Science Letters, 38, 129-176.Garnier V., Ohmenstetter D., Giuliani G., Fallick A.E., Phan T.T., Hoang Q.V., Pham V.L., Schawarz D., 2005. Basalt petrology, zircon ages and sapphire genesis from Dak Nong, southern Vietnam. Mineralogical Magazine, 69(1), 21-38.Gast P.W., 1968. Trace element fractionation and the origin of tholeiitic and alkaline magma types. Geochimica et Cosmochimica Acta, 32, 1057-1086.Gorshkov A.P, Ivanenko A.N., Rashidov V.A., 1984. Hydro-magnetic investigations of submarine volcanic zones in the marginal seas of Pacific Ocean (Novovineisky and Bien Dong seas). Pacific Ocean Geology, 1, 13-20.Gorshkov A.P., 1981. Investigation of submarine volcanoes during the 10th course of scientific research vessel ‘Volcanolog’. Volcanology and Seismology, 6, 39-45 (in Russian).Hart S.R., 1988. Heterogeneous mantle domains: signatures, genesis and mixing chronologies. Earth and Planetary Science Letters, 90, 273-296.Hirose K., Kushiro I., 1993. Partial melting of dry peridotites at high pressures: determination of composition of melts segregated from peridotite using aggregate of diamond. Earth Planet Science Letters, 114, 477-489.Hoang-Thi H.A., Choi S.H., Yongjae Yu Y-g., Pham T.H., Nguyen K.H., Ryu J-S., 2018. Geochemical constraints on the spatial distribution of recycled oceanic crust in the mantle source of late Cenozoic basalts, Vietnam. Lithos, 296-299 (2018), 382-395.Izokh A.E., Smirnov S.Z., Egorova V.V., Tran T.A., Kovyazin S.V., Ngo T.P., Kalinina V.V., 2010. The conditions of formation of sapphire and zircon in the areas of alkali-basaltoid volcanism in Central Vietnam. Russian Geology and Geophysics, 51(7), 719-733.Johnson K.T., Dick H.J.B. and Shimizu N., 1990. Melting in the oceanic upper mantle: An ion microprobe study of diopsides in abyssal peridotites. Journal of Geophysical Research (solid earth), 95, 2661-2678.Kölher T.P., Brey G.P., 1990. Calcium exchange between olivine and clinopyroxene calibrated as a geothermobarometer for natural peridotites from 2 to 60 kb with applications. Geochimica et Cosmochimica Acta, 54(9), 2375-2388.Kushiro I., 1996. Partial melting of a fertile mantle peridotite at high pressure: An experimental study using aggregates of diamond. In: A. Basu and S.R. Hart (Eds.), Earth Processes: Reading the Isotopic Code. AGU Monograph, 95, 109-122.Kushiro I., 1998. Compositions of partial melts formed in mantle peridotites at high pressures and their relation to those of primitive MORB. Physics of Earth and Planetary Interiors, 107, 103-110.Latin D., White N., 1990. Generating melt during lithospheric extension: Pure shear vs. simple shear. Geology, 18, 327-331.Lee T.-y. and Lawver L., 1995. Cenozoic plate reconstruction of Southeast Asia. In: M.F.J. Flower, R.J. McCabe and T.W.C. Hilde (Editors), Southeast Asia Structure, Tectonics, and Magmatism. Tectonophysics, 85-138.Li C-F., et al., 2015. Seismic stratigraphy of the central South China Sea basin and implications for neotectonics. Journal of Geophysical Research (solid earth), 120, 1377-1399. Doi:10.1002/2014JB011686.Li C.-F., et al., 2014. Ages and magnetic structures of the South China Sea constrained by deep tow magnetic surveys and IODP Expedition 349 Geochemistry, Geophysics, Geosystems, 14, 4958-4983.Malinovsky A.I., Rashidov V.A., 2015. Compositional characteristics of sedimentary and volcano-sedimentary rocks of Phu Quy-Catwick island group in the continental shelf of Vietnam. Bulletin of Kamchatka Regional Association of ‘Educational - Scientific’ Center, Earth Sciences, 27(3), 12-34 (in Russian with English summary).McCulloch M.T., Wasserburg G.J., 1978. Sm-Nd and Rb-Sr chronology of continental crust formation. Science, 200(4345), 1003-1011.Menzies M.A., Arculus R.L., Best M.G., et al., 1987. A record of subduction process and within-plate volcanism in lithospheric xenoliths of the southwestern USA. In P.H. Nixon (Editor), Mantle Xenoliths, John Wiley & Sons, Chichester, 59-74.Nguyen Hoang, Ogasawara M., Tran Thi Huong, Phan Van Hung, Nguyen Thi Thu, Cu Sy Thang, Pham Thanh Dang, Pham Tich Xuan, 2014. Geochemistry of Neogene Basalts in the Nghia Dan district, western Nghe An. J. Sci. of the Earth, 36, 403 -412.Nguyen Kinh Quoc, Nguyen Thu Giao, 1980. Cenozoic volcanic activity in Viet Nam. Geology and Mineral Resources, 2, 137-151 (in Vietnamese with English abstract).Nixon P.H., 1987 (Editor). Mantle xenoliths. John Wiley and Sons, 844p.Norman M.D. and Garcia M.O., 1999. Primitive magmas and source characteristics of the Hawaiian plume: petrology and geochemistry of shield picrites. Earth and Planetary Science Letters, 168, 27-44.Pollack H.N., Chapman D.S., 1977. On the regional variation of heat flow, geotherms and lithospheric thickness. Tectonophysics, 38, 279-296.Putirka K., 2008. Thermometers and Barometers for Volcanic Systems. In: Putirka, K., Tepley, F. (Eds.), Minerals, Inclusions and Volcanic Processes, Reviews in Mineralogy and Geochemistry, Mineralogical Soc. Am., 69, 61-120. Putirka K.D., 2017. Down the craters: where magmas stored and why they erupt. Methods and Further Reading. Supplement to February 2017 issue of Elements, 3(1), 11-16.Putirka K.D., Johnson M., Kinzler R., Longhi J., Walker D., 1996. Thermobarometry of mafic igneous rocks based on clinopyroxene-liquid equilibria, 0-30 kbar. Contributions to Mineralogy and Petrology, 123, 92-108. Putirka K.D., Mikaelian H., Ryerson F., Shaw H., 2003. New clinopyroxene-liquid thermobarometers for mafic, evolved, and volatile-bearing lava compositions, with applications to lavas from Tibet and the Snake River Plain, Idaho. American Mineralogist, 88, 1542-1554. Qi Q., Taylor L.A., Zhou X., 1995. Petrology and geochemistry of mantle peridotite xenoliths from SE China. Journal of Petrology, 36, 55-79.Sachtleben T.H., Seck H.A., 1981. Chemical control on the Al-solubility in orthopyroxene and its implications on pyroxene geothermometry. Contributions to Mineralogy and Petrology, 78, 157-65.Shaw D.M., 1970. Trace element fractionation during anataxis. Geochimica et Cosmochimica Acta, 34, 237-243.Sun S-S, McDonough W.F., 1989. Chemical and isotopic systematics of oceanic basalts: implications for mantle composition and processes. In Saunders A.D. and Norry, M.J. (eds) Magmatism in the Ocean Basins. Geological Society Special Publication, 42, 313-345.Takahashi E., 1986. Melting of a dry peridotite KLB-1 up to 14 Gpa: implications on the origin of peridotite upper mantle. J. Geophysical Research, 91, 9367-9382.Takahashi E., Kushiro I., 1983. Melting of a dry peridotite at high pressure and basalt magma genesis. American Mineralogist, 68, 859-879.Tamaki K., 1995. Upper mantle extrusion tectonics of southeast Asia and formation of western Pacific backarc basins. In: International Workshop: Cenozoic Evolution of the Indochina Peninsula, Hanoi/Do Son, April, p.89 (Abstract with Programs).Tapponnier P., Lacassin R., Leloup P.H., Shärer U., Dalai Z., Haiwei W., Xiaohan L., Shaocheng J., Lianshang Z., Jiayou Z., 1990. The Ailao Shan/Red River metamorphic belt: Tertiary left-lateral shear between Indochina and South China. Nature, 343(6257), 431-437.Tapponnier P., Peltzer G., La Dain A.Y., Armijo R., Cobbold P., 1982. Propagating extrusion tectonics in Asia: New insights from simple experiments with plasticine. Geology, 7, 611-616.Tatsumoto M., Basu A.R., Huang W., Wang J., Xie G., 1992. Sr, Nd, and Pb isotopes of ultramafic xenoliths in volcanic rocks of eastern China: enriched components EMI and EMII in subcontinental lithosphere. Earth Planet Sci. Letters, 113, 107-128.Taylor S.R., McLennan S.M., 1981. The composition and evolution of the continental crust: rare earth element evidence from sedimentary rocks. Philosophical Transactions of the Royal Society of London, 301, 381-399.Tu K., Flower M.F.J., Carlson R.W., Xie G-H., 1991. Sr, Nd, and Pb isotopic compositions of Hainan basalt (south China): Implications for a subcontinental lithosphere Dupal source. Geology, 19, 567-569.Tu K., Flower M.F.J., Carlson R.W., Xie G-H., Zhang M., 1992. Magmatism in the South China Basin 1. Isotopic and trace-element evidence for an endogenous Dupal component. Chemical Geology, 97, 47-63.Warren J.M., 2016. Global variations in abyssal peridotite compositions. Lithos, 248-251, 193-219.Webb S.A., Wood B.J., 1986. Spinel pyroxene- garnet relationships and their dependence on Cr/Al ratio. Contributions to Mineralogy and Petrology, 92, 471-480.Wells P.R.A., 1977. Pyroxene thermometry in simple and complex systems. Contributions to Mineralogy and Petrology, 62, 129-139.Whitford-Stark J.L., 1987. A survey of Cenozoic olcanism on mainland Asia, special paper, 213. Geological Society of America, 74p.Workman R.K., Hart S.R., 2005. Major and trace element composition of the depleted MORB mantle (DMM). Earth and Planetary Science Letters, 231, 53-72.Zhou P., Mukasa S., 1997. Nd-Sr-Pb isotopic, and major- and trace-element geochemistry of Cenozoic lavas from the Khorat Plateau, Thailand, sources and petrogenesis. Chemical Geology, 137, 175-193.Zindler A., Hart S.R., 1986. Chemical geodynamics. Annual Review of Earth and Planetary Sciences, 14, 493-571.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

BackgroundMyeloid-derived suppressor cells and tumor-associated macrophages inhibit anti-cancer immune responses systemically and in the tumor microenvironment, respectively, thereby limiting the efficacy of immune checkpoint blockers.1–5 However, the plasticity of myeloid cells may enable therapeutic intervention. The inhibitory receptor LILRB2/ILT4, which is expressed primarily in myeloid cells (monocytes, macrophages, dendritic cells and neutrophils), has emerged as a key immune checkpoint mediating the tolerogenic activity of myeloid cells associated with cancer.6–8 LILRB2/ILT4 has several ligands (classical and non-classical MHC-I, ANGPTL2/5, SEMA4A and CD1) and most of these are known to contribute to immune suppression in the tumor microenvironment.9–14 Thus, LILRB2/ILT4 is a promising target to overcome protumor myeloid cell activity. IO-108 is a fully human IgG4 therapeutic candidate that binds LILRB2/ILT4 with high affinity and specificity, thereby blocking its ligand interactions.MethodsWe used computational approaches to evaluate LILRB2/ILT4 expression in solid tumors from TCGA. IO-108 was discovered from a phage-displayed human single chain variable fragment antibody library. IO-108 contains the S228P mutation in the hinge region to prevent Fab-arm exchange. The binding affinity of IO-108 was measured using biolayer interferometry. The specificity of IO-108 was confirmed by two methods: 1) ELISA using recombinant LILR family members; 2) flow cytometry using cell lines engineered to express the extracellular domain of every LILR on the cell surface. Reporter and ligand binding assays were used to demonstrate LILRB2/ILT4 blocking activity of IO-108. Functional studies using primary immune cells from healthy donors and solid tumor cancer patients were performed to characterize IO-108 activity and mechanism of action. The in vivo efficacy of IO-108 is currently being evaluated in mouse models.ResultsWe found high LILRB2/ILT4 expression associated with macrophage infiltration in many solid tumor types from TCGA. IO-108 binds to LILRB2 with high affinity and specificity and blocks LILRB2/ILT4 ligand binding and activation. IO-108 enhanced the production of multiple proinflammatory cytokines in LPS- and anti-CD3- stimulated PBMC cultures from healthy donors and potentiated DC maturation/activation in response to LPS. Moreover, IO-108 polarized primary CD14+ cells isolated from solid tumor patient PBMC and ovarian cancer-associated ascites towards a proinflammatory phenotype and attenuated their suppressive effect on autologous T-cell proliferation and production of tumoricidal cytokines.ConclusionsThe preclinical characterization of IO-108, a novel LILRB2/ILT4 antagonistic antibody, demonstrates its ability to polarize tumor-associated myeloid cells towards a proinflammatory phenotype and suggests potential therapeutic benefit in tumors unresponsive to immune checkpoint blockade.AcknowledgementsWe acknowledge the funding support from National Cancer Institute (1R01 CA248736 and 2P30 CA142543), the Welch Foundation (AU-0042-20030616) and the Cancer Prevention and Research Institute of Texas (RP150551 and RP190561).Ethics ApprovalPBMCs were isolated from buffy coats of healthy donors (Interstate Blood Bank). Hematopoietic samples from cancer patients were obtained through the services of the Simmons Cancer Center‘s Tissue Management Shared Resource with IRB approved protocol (STU 102010-051). All animal work was approved and conducted under the oversight of the UT Southwestern Institutional Animal Care and Use Committee (IACUC).ReferencesHanahan D, Coussens LM. Accessories to the crime: functions of cells recruited to the tumor microenvironment. Cancer Cell 2012;21:309–22.Galluzzi L, Chan TA, Kroemer G, et al. The hallmarks of successful anticancer immunotherapy. Sci Transl Med 2018;10, DOI: 10.1126/scitranslmed.aat7807.3. Talmadge JE, Gabrilovich DI. History of myeloid-derived suppressor cells. Nat Rev Cancer 2013;13:739–52.Mantovani A, Marchesi F, Malesci A, et al. Tumour-associated macrophages as treatment targets in oncology. Nat Rev Clin Oncol 2017;14:399–416.Cassetta L, Pollard JW. Targeting macrophages: therapeutic approaches in cancer. Nat Rev Drug Discov 2018;17:887–904.Chen H-M, van der Touw W, Wang YS, et al. Blocking immunoinhibitory receptor LILRB2 reprograms tumor-associated myeloid cells and promotes antitumor immunity. J Clin Invest 2018;128:5647–62.Chang CC, Ciubotariu R, Manavalan JS, et al. Tolerization of dendritic cells by T(S) cells: the crucial role of inhibitory receptors ILT3 and ILT4. Nat Immunol 2002;3:237–43.Colonna M, Samaridis J, Cella M, et al. Human myelomonocytic cells express an inhibitory receptor for classical and nonclassical MHC class I molecules. J Immunol Baltim Md1950 1998;160:3096–100.Agaugué S, Carosella ED, Rouas-Freiss N. Role of HLA-G in tumor escape through expansion of myeloid-derived suppressor cells and cytokinic balance in favor of Th2 versus Th1/Th17. Blood 2011;117:7021–31.He J, Xu J, Yu X et al. Overexpression of ANGPTL2 and LILRB2 as predictive and therapeutic biomarkers for metastasis and prognosis in colorectal cancer. Int J Clin Exp Pathol 2018;11:2281–94.Jeong S, Park S, Park B-W et al. Human Leukocyte Antigen-G (HLA-G) Polymorphism and Expression in Breast Cancer Patients. Tang J (ed.). PLoS ONE 2014;9:e98284.Iyer AS, Chapoval SP. Neuroimmune Semaphorin 4A in Cancer Angiogenesis and Inflammation: A Promoter or a Suppressor? Int J Mol Sci 2018;20, DOI: 10.3390/ijms20010124.13. Li D, Wang L, Yu L et al. Ig-like transcript 4 inhibits lipid antigen presentation through direct CD1d interaction. J Immunol Baltim Md 1950 2009;182:1033–40.Li D, Hong A, Lu Q et al. A novel role of CD1c in regulating CD1d-mediated NKT cell recognition by competitive binding to Ig-like transcript 4. Int Immunol 2012;24:729–37.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Abstract High-grade serous ovarian cancer (HGSOC) is an archetypal cancer of genomic instability patterned by distinct mutational processes, a high degree of tumor heterogeneity and intraperitoneal spread. As immunotherapies have thus far proven ineffective in this disease, we sought to establish the determinants of immune recognition, avoidance and evasion in disease natural history to gain insight into the co-evolutionary processes underlying malignant progression and host immunity. Accordingly we linked mutational processes and anatomic sites of tumor foci as determinants of tumor microenvironment (TME) cellular phenotypes within and between patients using genome-based stratification of hom*ologous recombination proficient (HRP) and deficient (HRD) disease subtypes, and profiling single cell phenotypes from ~1 million cells including cancer cells, T cells, myeloid cells and fibroblasts derived from single cell RNA sequencing, and in situ spatial profiling of histopathology, cancer cell, T cell and macrophage states of 160 tumor sites obtained from 42 treatment-naive patients. Mutational processes in HRD-Dup (BRCA1 mutant-like) tumors were associated with cancer cell-intrinsic JAK/STAT signaling and predominance of highly-differentiated dysfunctional CD8+ T cells in the TME; HRD-Del (BRCA2 mutant-like) tumors were associated with cancer cell-intrinsic NF-κB and TNFα signaling and expansion of M2-type macrophages; and foldback inversion (FBI, HRP) tumors were associated with cancer cell-intrinsic TGFβ signaling and overall immune exclusion, with a predominance of naive/central memory-like T cells. Increased neoantigen burden and HLA loss of heterozygosity (LOH) were defining genomic features of the HRD, but not FBI tumors. These mechanisms of escape from immune predation, with distinct signalling activity and losses of HLA allelic diversity in HRD tumors, connect evolutionary selection with immunological phenotypic states. Multi-region sampling revealed substantial spatial variation, highlighting site-specific properties of the ovary and fallopian tube as putative “immune-privileged” sites. These results establish that in patients with widespread intraperitoneal disease, the local properties of organ sites may determine malignant cell selection and immune pruning. Furthermore, we observed that spatial cellular topology is a major determinant of tumor-immune interactions by in situ protein measurements, revealing ubiquitous PD1-PDL1 interactions in HRD tumors. Together, our findings yield mechanistic insights for how distinct mutational processes in HGSOC lead to diverse patterns of within- and between- patient variation in immune resistance, which can be exploited to optimize future immuno-therapeutic treatment strategies. Citation Format: Ignacio Vázquez-García, Florian Uhlitz, Nicholas Ceglia, Jamie L. Lim, Michelle Wu, Neeman Mohibullah, Arvin Eric B. Ruiz, Kevin M. Boehm, Viktoria Bojilova, Christopher J. Fong, Tyler Funnell, Diljot Grewal, Eliyahu Havasov, Samantha Leung, Arfath Pasha, Druv M. Patel, Maryam Pourmaleki, Nicole Rusk, Hongyu Shi, Rami Vanguri, Marc J. Williams, Allen W. Zhang, Vance Broach, Dennis S. Chi, Arnaud Da Cruz Paula, Ginger J. Gardner, Sarah H. Kim, Matthew Lennon, Kara Long Roche, Yukio Sonoda, Oliver Zivanovic, Ritika Kundra, Agnes Viale, Yonina Bykov, Fatemeh N. Derakhshan, Luke Geneslaw, Ana Maroldi, Andrea Schietinger, Travis J. Hollmann, Samuel F. Bakhoum, Robert A. Soslow, Lora H. Ellenson, Nadeem Abu-Rustum, Carol Aghajanian, Claire F. Friedman, Andrew McPherson, Britta Weigelt, MSK SPECTRUM Consortium, Dmitriy Zamarin, Sohrab P. Shah. Immune and malignant cell phenotypes of ovarian cancer are determined by distinct mutational processes [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2022; 2022 Apr 8-13. Philadelphia (PA): AACR; Cancer Res 2022;82(12_Suppl):Abstract nr 2553.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

-Leslie G. Desmangles, Joan Dayan, Haiti, history, and the Gods. Berkeley: University of California Press, 1995. xxiii + 339 pp.-Barry Chevannes, James T. Houk, Spirits, blood, and drums: The Orisha religion in Trinidad. Philadelphia: Temple University Press, 1995. xvi + 238 pp.-Barry Chevannes, Walter F. Pitts, Jr., Old ship of Zion: The Afro-Baptist ritual in the African Diaspora. New York: Oxford University Press, 1993. xvi + 199 pp.-Robert J. Stewart, Lewin L. Williams, Caribbean theology. New York: Peter Lang, 1994. xiii + 231 pp.-Robert J. Stewart, Barry Chevannes, Rastafari and other African-Caribbean worldviews. London: Macmillan, 1995. xxv + 282 pp.-Michael Aceto, Maureen Warner-Lewis, Yoruba songs of Trinidad. London: Karnak House, 1994. 158 pp.''Trinidad Yoruba: From mother tongue to memory. Tuscaloosa: University of Alabama Press, 1996. xviii + 279 pp.-Erika Bourguignon, Nicola H. Götz, Obeah - Hexerei in der Karibik - zwischen Macht und Ohnmacht. Frankfurt am Main: Peter Lang, 1995. 256 pp.-John Murphy, Hernando Calvo Ospina, Salsa! Havana heat: Bronx Beat. London: Latin America Bureau, 1995. viii + 151 pp.-Donald R. Hill, Stephen Stuempfle, The steelband movement: The forging of a national art in Trinidad and Tobago. Philadelphia: University of Pennsylvania Press, 1995. xx + 289 pp.-Hilary McD. Beckles, Jay R. Mandle ,Caribbean Hoops: The development of West Indian basketball. Langhorne PA: Gordon and Breach, 1994. ix + 121 pp., Joan D. Mandle (eds)-Edmund Burke, III, Lewis R. Gordon ,Fanon: A critical reader. Oxford: Blackwell, 1996. xxi + 344 pp., T. Denean Sharpley-Whiting, Renée T. White (eds)-Keith Alan Sprouse, Ikenna Dieke, The primordial image: African, Afro-American, and Caribbean Mythopoetic text. New York: Peter Lang, 1993. xiv + 434 pp.-Keith Alan Sprouse, Wimal Dissanayake ,Self and colonial desire: Travel writings of V.S. Naipaul. New York : Peter Lang, 1993. vii + 160 pp., Carmen Wickramagamage (eds)-Yannick Tarrieu, Moira Ferguson, Jamaica Kincaid: Where the land meets the body: Charlottesville: University Press of Virginia, 1994. xiii + 205 pp.-Neil L. Whitehead, Vera Lawrence Hyatt ,Race, discourse, and the origin of the Americas: A new world view. Washington DC: Smithsonian Institution Press, 1995. xiii + 302 pp., Rex Nettleford (eds)-Neil L. Whitehead, Patricia Seed, Ceremonies of possession in Europe's conquest of the new world, 1492-1640. Cambridge: Cambridge University Press, 1995. viii + 199 pp.-Livio Sansone, Michiel Baud ,Etnicidad como estrategia en America Latina y en el Caribe. Arij Ouweneel & Patricio Silva. Quito: Ediciones Abya-Yala, 1996. 214 pp., Kees Koonings, Gert Oostindie (eds)-D.C. Griffith, Linda Basch ,Nations unbound: Transnational projects, postcolonial predicaments, and deterritorialized nation-states. Langhorne PA: Gordon and Breach, 1994. vii + 344 pp., Nina Glick Schiller, Cristina Szanton Blanc (eds)-John Stiles, Richard D.E. Burton ,French and West Indian: Martinique, Guadeloupe and French Guiana today. Charlottesville: University Press of Virginia; London: Macmillan Caribbean, 1995. xii + 202 pp., Fred Réno (eds)-Frank F. Taylor, Dennis J. Gayle ,Tourism marketing and management in the Caribbean. New York: Routledge, 1993. xxvi + 270 pp., Jonathan N. Goodrich (eds)-Ivelaw L. Griffith, John La Guerre, Structural adjustment: Public policy and administration in the Caribbean. St. Augustine: School of continuing studies, University of the West Indies, 1994. vii + 258 pp.-Luis Martínez-Fernández, Kelvin A. Santiago-Valles, 'Subject People' and colonial discourses: Economic transformation and social disorder in Puerto Rico, 1898-1947. Albany: State University of New York Press, 1994. xiii + 304 pp.-Alicia Pousada, Bonnie Urciuoli, Exposing prejudice: Puerto Rican experiences of language, race, and class. Boulder: Westview Press, 1996. xiv + 222 pp.-David A.B. Murray, Ian Lumsden, Machos, Maricones, and Gays: Cuba and hom*osexuality. Philadelphia: Temple University Press, 1996. xxvii + 263 pp.-Robert Fatton, Jr., Georges A. Fauriol, Haitian frustrations: Dilemmas for U.S. policy. Washington DC: Center for strategic & international studies, 1995. xii + 236 pp.-Leni Ashmore Sorensen, David Barry Gaspar ,More than Chattel: Black women and slavery in the Americas. Bloomington: Indiana University Press, 1996. xi + 341 pp., Darlene Clark Hine (eds)-A. Lynn Bolles, Verene Shepherd ,Engendering history: Caribbean women in historical perspective. Kingston: Ian Randle; London: James Currey, 1995. xxii + 406 pp., Bridget Brereton, Barbara Bailey (eds)-Bridget Brereton, Mary Turner, From chattel slaves to wage slaves: The dynamics of labour bargaining in the Americas. Kingston: Ian Randle; Bloomington: Indiana University Press; London: James Currey, 1995. x + 310 pp.-Carl E. Swanson, Duncan Crewe, Yellow Jack and the worm: British Naval administration in the West Indies, 1739-1748. Liverpool: Liverpool University Press, 1993. x + 321 pp.-Jerome Egger, Wim Hoogbergen, Het Kamp van Broos en Kaliko: De geschiedenis van een Afro-Surinaamse familie. Amsterdam: Prometheus, 1996. 213 pp.-Ellen Klinkers, Lila Gobardhan-Rambocus ,De erfenis van de slavernij. Paramaribo: Anton de Kom Universiteit, 1995. 297 pp., Maurits S. Hassankhan, Jerry L. Egger (eds)-Kevin K. Birth, Sylvia Moodie-Kublalsingh, The Cocoa Panyols of Trinidad: An oral record. London & New York: British Academic Press, 1994. xiii + 242 pp.-David R. Watters, C.N. Dubelaar, The Petroglyphs of the Lesser Antilles, the Virgin Islands and Trinidad. Amsterdam: Foundation for scientific research in the Caribbean region, 1995. vii + 492 pp.-Suzannah England, Mitchell W. Marken, Pottery from Spanish shipwrecks, 1500-1800. Gainesville: University Press of Florida, 1994. xvi + 264 pp.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

The present volume marks the completion of a large research project by the Geological Survey of Denmark and Greenland (GEUS), focused on the northern part of the Palaeoproterozoic Nagssugtoqidian orogen of central West Greenland, and carried out by a team of Danish and international participants. The project comprised geological mapping as well as structural, geochronological, geochemical and economic geological studies. This volume contains reports on both Archaean and Palaeoproterozoic geology as well as a study of neotectonic brittle structures. The field work was carried out in 2000-2003 in the region between Nordre Strømfjord and Jakobshavn Isfjord (see e.g. van Gool & Piazolo 2006, this volume, fig. 1). The project had two immediate purposes, namely to establish an overview of the mineral resource potential of supracrustal rocks in the region between 66° and 70°15'N, and produce four new geological sheets in the Survey's 1:100 000 map series. The first collection of papers about the Nagssugtoqidian orogen, published by the Geological Survey of Greenland (GGU, now part of GEUS), dates back to 1979 (Korstgård 1979). The investigations in this period were mainly based on field descriptions and structural analysis of coastal areas in the southern and central parts of the orogen, combined with limited petrographical, palaeomagnetic and geochronological studies; the results also comprised the first 1:100 000 geological map from within the Nagssugtoqidian orogen (Olesen 1984). The Proterozoic age of the orogen had been established, but it was believed that most, if not all of the quartzofeldspathic basem*nt gneisses were of Archaean origin. Subsequent work in the Nagssugtoqidian orogen by GGU in the 1980s showed that besides Archaean orthogneisses and supracrustal rocks, the central part of the orogen also comprises the root zone of a Palaeoproterozoic magmatic arc and associated panels of Palaeoproterozoic volcanic and metasedimentary rocks (Kalsbeek et al. 1987). These results were confirmed during further investigations by the Danish Lithosphere Centre (DLC) in 1994-1999, and the plate-tectonic collisional history of the southern and central Nagssugtoqidian orogen was described in detail (van Gool et al. 2002). However, these studies added little to previous knowledge of the northern parts of the orogen in the Kangaatsiaq-Aasiaat-Qasigiannguit region, knowledge that was largely based on coastal reconnaissance by Henderson (1969) at the time when the entire orogen was still believed to consist of Archaean rocks. Another project preceding the present work was carried out by GGU in 1988-1991 immediately north of the Nagssugtoqidian orogen, in the southernmost part of the likewise Palaeoproterozoic Rinkian fold belt (Disko Bugt project, Kalsbeek 1999). It was shown that also the latter region comprises Palaeoproterozoic (meta)sedimentary rocks, and that most of the Archaean basem*nt is strongly overprinted by Palaeoproterozoic structures that were formed during overall W- or NW-directed lateral tectonic transport. Although these structures might be related to similar structures in the Nagssugtoqidian orogen, the relationship between the Nagssugtoqidian orogen and the Rinkian fold belt remained speculative. The only previous economic geological study of regional extent in central West Greenland was an airborne reconnaissance study supplemented by local field work, which was carried out in the early 1960s by Kryolitselskabet Øresund A/S. This work resulted in the discovery of a massive sulphide deposit at Naternaq (Lersletten), which was studied again in some detail in 2001 by the Survey (Østergaard et al. 2002) but not reported on in the present volume. The present volume comprises 12 papers with topics ranging geochronologically from mid-Archaean to Palaeogene, and geographically from the southern Nagssugtoqidian foreland to the central part of the Rinkian fold belt. Many of the papers deal with the northern part of the Nagssugtoqidian orogen and are related to the recent field work in that region, while a few contributions are rooted in DLC- or other projects. The papers have been arranged in approximate chronological order and are grouped in terms of their main subjects. The two first papers, by Hollis et al. and Moyen & Watt, deal with Archaean supra- and infracrustal rocks in the northern Nagssugtoqidian orogen: their origin, ages, and structural and metamorphic evolution. These papers provide insight into the age and origin of the continental crustal orthogneisses and granites that underlie most of the region, and discuss the relationships between the supracrustal and plutonic components, using zircon U-Pb age determinations and major and trace element geochemical characteristics. Also the question of Palaeoproterozoic tectonic overprint is discussed, with the conclusion from both study areas that most of the observed structures are Archaean. The third paper with focus on Archaean geology, by Stendal et al., describes a small gold prospect at Attu likewise in the northern Nagssugtoqidian orogen, and discusses the age of the prospect and its host rocks using Pb-Pb geochronology of magnetite. It is concluded that the host rocks at Attu may be as old as 3162 ± 43 Ma, and that the gold prospect itself is around 2650 Ma in age. The fourth paper, by Mayborn & Lesher, is a thorough review of the Kangâmiut dyke swarm in the southern Nagssugtoqidian orogen and its foreland. It includes new whole-rock and mineral chemical data, and a list of sampling sites and corresponding field data. The emplacement mechanism and depth of the dyke swarm are discussed in detail, and it is concluded that the dykes were emplaced during the initial rifting prior to the Nagssugtoqidian collision and that they are unrelated to subduction processes (contrary to the belief by some previous authors). The next three papers provide geochronological constraints on the ages of supra- and infracrustal rocks and the deformation and metamorphism in the northern Nagssugtoqidian orogen, and on late orogenic uplift in the central Rinkian fold belt. In the first of these papers Thrane & Connelly employ zircon U-Pb age determinations (mainly using the laser ICP-MS method), and for the first time provide unequivocal documentation that the Naternaq supracrustal belt is of Palaeoproterozoic age. Other zircon age data from a synkinematic granite southeast of Kangaatsiaq show that the large fold structures in this region are of Archaean age. The subsequent paper by Stendal et al. presents Pb-Pb ages and isotopic signatures of magnetite in amphibolites; the obtained ages are younger than 1800 Ma and are related to cooling of the orogen. Stepwise leaching Pb-Pb ages of monazite and allanite in pegmatites fall in the range of 1750-1800 Ma, and are interpreted to date the emplacement of these rocks. The third paper in this group, by Sidgren et al., deals with new 40Ar/39Ar ages of around 1790 Ma (hornblende) and 1680 Ma (muscovite) from Archaean and Palaeoproterozoic rocks in the central Rinkian fold belt, which are interpreted as orogenic cooling ages. The hornblende ages are significantly older than such hornblende ages previously obtained from the central and northern Nagssugtoqidian orogen, pointing to different uplift histories in the two regions. This may in turn suggest that the Rinkian continental collision preceded that in the Nagssugtoqidian orogen. Four of the remaining five papers deal with the Nagssugtoqidian structural evolution. In the first of these, van Gool & Piazolo present a new method of structural analysis, where a geographical information system (GIS) is used as a framework for visualisation and analysis of large amounts of structural data. The paper graphically presents an overview of thousands of data points within an area of approximately 160 × 180 km in the central and northern parts of the Nagssugtoqidian orogen. This interesting data set points directly towards the two next papers, where crustal-scale structures in the same region and their origin are discussed: Sørensen et al. address the prominent Nordre Strømfjord shear zone just south of this block, and describes the structural and metasomatic transition into the shear zone by means of aeromagnetic and lithological map patterns and geochemical data. Another paper, by Mazur et al., addresses a prominent break in the structural pattern within the Kangaatsiaq-Aasiaat area, where the southern part acted as a rigid block during the Nagssugtoqidian orogeny and thus preserved its Archaean structure. The fourth paper in this group, by Korstgård et al., combines rock and aeromagnetic data to discuss the relationship between structure, metamorphic facies and total magnetic field intensity anomalies in the southern Nagssugtoqidian orogen. The authors show that static metamorphic boundaries are gradual, whereas boundaries along deformation zones are abrupt. The last paper, by Wilson et al., is a novel remote sensing and field geological analysis of onshore brittle structures related to the complex Ungava fault zone in the Davis Strait, which developed during the Cretaceous-Palaeogene opening of the Labrador Sea - Davis Strait - Baffin Bay seaway. The study area is located in the central Nagssugtoqidian orogen, and the authors carefully establish a distinction between old Nagssugtoqidian and younger structures in the basem*nt rocks and identify five main sets of young lineaments. They conclude that the onshore fault patterns are predominantly of strike-slip nature, and that they reflect the stress fields that governed the opening of the seaway. Acknowledgements The editors are grateful to the 14 external reviewers, each of whom reviewed one or more of the individual papers, for their thorough and constructive work.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

The alkali volcanics and intrusive rocks, dated at around 35-33Ma, are cut by mineralised northeast and east trending faults showing predominant evidence for strike-slip. Mineralisation includes haematite-Au-Cu and is accompanied by iron-rich alteration of the volcanic rocks. Detailed assessment of the geometry of the fault system at Pu Sam Cap suggests that the faults formed as a Riedel shear system during left-lateral slip within the Song Hong-Song Chay shear zone and the numerous contemporaneous northwest trending faults to the south; the northeast trending faults are interpreted as dextral “book-end’’ faults between major northwest trending faults enclosing the Pu Sam Cap massif. As mineralisation is hosted within these faults and is also associated with lamprohyric dykes it confirms a thermal event younger than the alkaline volcanics and syenitic intrusives at Pu Sam Cap, suggesting a hidden, young porphyry system. The age of faulting, and thus the maximum age for this young intrusive event, is attributed to the 23-21Ma period of late-stage left-lateral strike-slip motion across northwest Vietnam.ReferencesAnczkiewicz R., Viola G., Muntener O., Thrirlwall M., Quong N.Q., 2007. Structure and shearing conditions in the Day Nui Con Voi massif: implications for the evolution of the Red River Fault. Tectonics 26: TC2002.Cao Shunyun, Liu Junlai, Leis B., Zhao Chunquiang 2010. New zircon U/Pb geochronology of the post-kinematic granitic plutons in Diancang Shan Massif along the Ailao-Shan-Red River Shear Zone and its geological implications. Acta Geologica Sinica (English Edition), 84, 1474-1487.Chung S.-L., Lee T., Lo C., et al., 1997. Intraplate extension prior to continental extrusion along the Ailao Shan-Red River shear zone.Geology, 25, 311-314.Cloos H., 1928. Experimentezurinnern Tektonik. Zentralblatt fur Mineralogie und Palaeontologie, 1928, 609-621.Findlay R.H., Phan Trong Trinh 1997. The structural setting of the Song Ma region, Vietnam, and the Indochina-South China plate boundary problem. Gondwana Research, 1, 11-33.Jolivet L., Beysasac O., Goffe B., Avigad D., Leprevrier C., Maluski H., Ta Trong Thang, 2001. Oligo-Miocene midcrustal subhorizontal shear in Indochina. Tectonics, 20, 46-57.Khuong The Hung 2010. The complex tectonic events and their influence on formation of mineral deposits in northwest Vietnam. Unpublished PhD Thesis, University of Science and Technology, Cracow, 167p.Leloup P.H., N. Arnau, R. Lacassin, J.R. Kienast, T.M. Harrison, P.T. Trinh, A. Replumaz and P. Tapponnier, 2001. New constraints on the structure, thermochronology and timing of the Ailao Shan - Red river shear zone, SE Asia, J. G. R., 106, 6657-6671.Leloup PH.., R. Lacassin, P. Tapponnier, U. Scharer, Zhong Dalai, Liu Xaohan, Zhangshan, Ji Shaocheng and PT.Trinh, 1995. The Ailao Shan - Red river shear zone (Yunnan, China), Tertiary transform boundary of Indochina, Tectonophysics, 251, 3-84. Leprevier C., Maluski H., Nguyen Van Vuong, Roques D., Axente V., Rangin C., 1996. Indosinian NW-trending shear zones within the Truong Son belt, Vietnam: 40Ar-39Ar Triassic ages and Cretaceous to Cenozoic overprints. Tectonophysics, 283, 105-107.Lien-Sheng Zhang, Scharer U. 1999. Age and origin of magmatism along the Cenozoic Red River shear belt, China. Contributions to Mineralogy and Petrology, 134, 67-85.Nagy E.A., Scharer U., Minh N.T., 2000. Oligo-Miocene granitic magmatismin central Vietnam and implications for continental deformation in Indochina. Terra Nova, 12, 67-76.Nguyen Thi Bich Thuy, 2016. Isotop dating U-Pb Zircon of Syenit Formation, Pu Sam Cap. Journal of Geology, A Serie, 356, 30-36. (In Vietnamese).Pei-Long Wang, Ching-Hua Lo, Tung-Yi Lee, Sun-ling Chun, Ching-Yan Lan, Nguyen Trong Yem 1998. Thermochronological evidence for the movement of the Ailo Shan-Red River shear zone, a perspective from Vietnam. Geology, 26, 887-890.Phan Trong Trinh, Nguyen Trong Yem, Herve L.P., Tapponnier P., 1994. Late Cenozoic stress fields in North Vietnam from microtectonic measurements. Proceedings of the International Workshop on Seismotectonics and Seismic Hazard in Southeast Asia. Geological Survey of SR Vietnam, Hanoi, 182-186.Riedel W., 1929. Zur Mechanikgreologischer Brucherscheinungen. Zentralblatt fur Mineralogie und Palaeontologie, Abhandlung B, 354-368.Scharer U., Tapponnier P., Lacassin R., Leloup P.H., Dalai Z., Shaosheng J., 1990. Intraplate tectonics in Asia: a precise age for large-scale Miocene movement along the Ailao Shan-Red River shear zone, China. Earth and Planetary Science Letters, 97, 65-77.Scharer U., Zhang L.S., Tapponnier P., 1994. Duration of strike-slip movements in large shear zones: the Red River belt, China. Earth and Planetary Science Letters, 126, 379-397.Searle M.P., 2006. Role of the Red River Shear zone, Yunnan and Vietnam, in the continental extrusion of SE Asia. Journal of the Geological Society, London, 163, 1025-1036.Searle M.P., Meng-Wan Yeh, Te-Hsien Lin, Sun-Lin Chung, 2010. Structural constraints on the timing of left-lateral shear along the Red River shear zone in the Ailao Shan and Diancang Shan Ranges, Yunnan, SW China. Geosphere, 6, 316-338.Tapponnier P., Lacassin R., Leloup H., Scharer U., Zhong Dalai, Wu Hawei, Liu Ziaohan, Ji Shaocheng, Zhang Lianshang, Zong Jiayou, 1990. The Ailao Shan/ Red River metamorphic belt: Tertiary left-lateral shear between Indochina and south China. Nature, 342, 431-437.Tchalenko J.S., 1970. Similarities between shear zones of different magnitudes. Bulletin of the Geological Society of America, 81, 1625-1640.Viola G., Anczkiewicz R. 2009. Exhumation history of the Red River shear zone in northern Vietnam: new insights from zircon and apatite fission-track analysis. Journal of Asian Earth Sciences, 33, 78-90.Yang Yiseng, Hong Qun, Hu Huan-ting, Hieu Pham Trung, Nguyen Thi Bich Thuy, Chen Fu-kun, 2013. Geochemical characteristics and genesis of the Cenozoic porphyry in the Laizhou area, northwestern Vietnam. Acta Petrologica Sinica, 29(3), 899-911. (In Chinese with English abstract, full English version through Google Translate).

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Настоящая работа является первым общим описанием на русском языке двух некрополей Кампокиаро (Кампобассо, Италия) – Виченне и Морионе, датируемых последней третью VII в. – началом VIII в. Культурное содержание некрополей показывает прочные связи с населением центральноазиатского происхождения. Важнейшим признаком некрополей являются захоронения с конем, соответствующие евразийскому кочевому погребальному обряду. Автор поддержал выводы европейских исследователей о том, что с большой долей вероятности некрополи оставлены булгарами дукса–гаштальда Алзеко, зафиксированными Павлом Диаконом в VIII в. на территориях Бояно, Сепино и Изернии. Аналогии некрополей Кампокиаро с погребениями Аварского каганата показывают присутствие в аварском обществе булгар со схожим погребальным обрядом. Из тысяч погребений с конем, оставленных аварским населением, булгарам могла принадлежать большая часть. Авары и булгары составляли основу и правящую верхушку каганата. Народ Алзеко являлся той частью булгар, которая в 631 г. боролась за каганский престол, что указывает на высокое положение булгар и их большое количество. После поражения эта группа булгар мигрировала последовательно в Баварию, Карантанию и Италию. Несколько десятков лет проживания в венедской, а затем в лангобардской и романской среде привели к гетерогенности погребального инвентаря, но не изменили сам обряд. Булгары лангобардского королевства составляли новый военный слой, который представлял из себя профессиональную кавалерию, получивший землю. Эта конная дружина является ранним примером европейского феодального воинского и социального сословия, которое станет называться рыцарством. Библиографические ссылки Акимова М.С. Материалы к антропологии ранних болгар // Генинг В.Ф., Халиков А.Х. Ранние болгары на Волге (Больше–Тарханский могильник). М.: Наука, 1964. С. 177–191. Амброз А.К. Кинжалы VI – VIII вв, с двумя выступами на ножнах // СА. 1986. № 4. С. 53–73. Безуглов С.И., Ильюков Л.С. Памятник позднегуннской эпохи в устье Дона // Средневековые древности Дона / Ред. Ю.К. Гугуев. М.–Иерусалим: Мосты и культуры, 2007. C. 25–48. Бешевлиев В. Пръвобългарите. История, бит и култура. Пловдив: Фондация «Българско историческо наследство», 2008. 505 с. Гавритухин И.О., Иванов А.Г. Погребение 552 Варнинского могильника и некоторые вопросы изучения раннесредневековых культур Поволжья // Пермский мир в раннем средневековье / Отв. ред. А.Г. Иванов. Ижевск: УИИЯЛ УрО РАН, 1999. С. 99–159. Добиаш–Рождественская О.А. Ранний фриульский минускул и одна из проблем жизни и творчества лангобардского историка VIII в. // Вспомогательные исторические дисциплины / Под ред. А. С. Орлова. М.; Л.: Изд–во АН СССР, 1937. С. 109–140. Засецкая И.П. Культура кочевников южнорусских степей в гуннскую эпоху (конец IV–V вв.). СПб.: АО "Эллипс", 1994. 221 с. Казанский М.М. Оногуры в постгуннское время на Дону // Дивногорский сборник / Труды музея-заповедника «Дивногорье». Вып. 6. / под ред. А. З. Винникова. Воронеж: Изд.– полигр. центр «Научная книга», 2016. С. 96–111. Казанский М.М. Хронологические индикаторы степных древностей постгуннского времени в Восточной Европе // НАВ. 2019. Т. 18 (2). С. 109–124. Кардини Ф. Истоки средневекового рыцарства // Пер. с ит. В.П. Гайдук / Общ. ред. В.И. Уколова, Л.А. Котельникова. М.: Прогресс, 1987. 384 с. Комар А.В., Кубышев А.И., Орлов Р.С. Погребения кочевников VI–VII вв. из Северо–Западного Приазовья // Степи Европы в эпоху средневековья. Т. 5. Хазарское время / Гл.ред. А.В.Евглевский Донецк: ДонНУ, 2006. С. 245–376. Кондукторова Т.С. Антропологическая характеристика черепов из Верхнего Чир–Юртовского могильника в Дагестане // ВА. 1967. Вып. 25. С. 117–129. Красильников К.И. Могильник древних болгар у с. Желтое на Северском Донце // Проблеми на прабългарската история и култура. София: БАН, Нац. Археол. институт с музей филиал Шумен, Аргес, 1991. Т. 2. С. 62–81. Красильников К.И., Красильникова Л.И. Могильник у с. Лысогоровка – новый источник по этноистории степей Подонцовья раннего средневековья // Степи Европы в эпоху средневековья. Т 4. Хазарское время / Гл.ред. А.В. Евглевский. Донецк: ДонНУ, 2005. С. 187–244. Красильников К.И., Руженко А.А. Погребение хирурга на древнеболгарском могильнике у с. Желтое // СА. 1981. № 2. С. 282–289. Кузнецова Т.И. Павел Диакон. Из «Истории лангобардов» // Памятники средневековой латинской литературы IV–IX веков / Отв. ред. М. Е. Грабарь-Пассек и М. Л. Гаспаров. М.: Наука, 1970. С. 243–257. Медникова М.Б. Трепанации у древних народов Евразии. М.: Научный мир, 2001. 304 с. Мингазов Ш.Р. Болгары Алзеко в Баварии, Карантании и Италии как пример автономной части этнокультурной общности // Восточная Европа в древности и средневековье. Античные и средневековые общности: XXIX Чтения памяти члена-корреспондента АН СССР В.Т. Пашуто. Москва, 19–21 апреля 2017 / Отв. Ред. Е. А. Мельникова. М: Институт всеобщей истории РАН, 2017. С. 160–164. Мингазов Ш.Р. Следы взаимовлияния европейской и азиатской социокультурных моделей: булгары в Италии (VI–VIII вв.) // Восточная Европа в древности и средневековье. Сравнительные исследования социокультурных практик: XXXII Чтения памяти члена корреспондента АН СССР В.Т. Пашуто. Москва, 15–17 апреля 2020 / Отв. Ред. Е. А. Мельникова. М.: Институт всеобщей истории РАН, 2020. С. 162–166. Нестеров С.П. Конь в культах тюркоязычных племен Центральной Азии в эпоху средневековья. Новосибирск: Наука. Сиб. отд–ие АН СССР, 1990. 143 с. Павел Диакон. История лангобардов / Пер. с лат., ст. Ю.Б. Циркина. СПб.: Азбука–классика, 2008. 318 с. Решетова И.К. Население донецко–донского междуречья в раннем средневековье: Палеоантропологическое исследование. СПб.: Нестор–История, 2015. 132 с. Решетова И.К. Описание индивидов с трепанированными черепами среди носителей Салтово–маяцкой культуры: медицинская практика или культ? // Этнографическое обозрение. 2012. № 5. С. 151–157. Ронин В.К. «История лангобардов» Павла Диакона // Свод древнейших письменных известий о славянах / Отв. ред. Л. А. Гиндин, Г. Г. Литаврин. М.: Издательская фирма «Восточная литература» РАН, 1995. Т. II. С. 480–501. Ронин В.К. Так называемая Хроника Фредегара // Свод древнейших письменных известий о славянах / Отв. ред. Л. А. Гиндин, Г. Г. Литаврин. М.: Издательская фирма «Восточная литература» РАН, 1995. Т. II. С. 364–397. Трифонов Ю.И. Об этнической принадлежности погребений с конем древнетюркского времени (в связи с вопросом о структуре погребального обряда тюрков–тугю // Тюркологический сборник 1972. / Отв. ред. А.Н. Кононов. М.: Наука, 1973. С. 351–374. Храпунов И.Н., Казанский М.М. Погребение № 114 на могильнике Нейзац (предгорный Крым) и древности кочевников Северного Причерноморья второй половины V — первой половины VI в. // КСИА. Вып. 238. М.: ИА РАН, 2015. С. 170–194. Шишманов И. Българите в “Orlando furioso” и въ по–старата френска драма // Български преглед. VI. Кн. 8. София: Придворна печатница, 1900. Година С. 67–84. Ceglia V. Campochiaro. La necropoli di Vicenne // L’oro degli Avari: popolo delle steppe in Europa. Milano: Inform, 2000. P. 212–221. Ceglia V. Campochiaro: la necropoli altomedievale di Vicenne (CB) // V Settimana beni culturali. Tutela. Catalogo della mostra. Matrice: Soprintendenza archeologica e per i beni ambientali, architettonici, artistici e storici del Molise, 1989. P. 63–67. Ceglia V. Interventi di recupero dei siti sparsi e necropolis // Conoscenze. Campobasso: Soprintendenza archeologica e per i beni ambientali, architettonici, artistici e storici del Molise, 1994. Vol. 7. P. 17–20. Ceglia V. La Necropoli altomedioevale di Vicenne nel Comune di Campochiaro // Almanacco del Molise. Campobasso: Habacus Edithore,1989. Ed. 21, vol. II. P. 153–158. Ceglia V. La necropoli di Campochiaro (Italia) // Roma e i Barbari. La nascita di un nuovo mondo. Catalogo della Mostra (Venezia, 26 gennaio –20 luglio 2008) / A cura di J.J. Aillagon. Milano: Skira, 2008. P. 469–475. Ceglia V. Lo scavo della necropoli di Vicenne // Conoscenze. Campobasso: Soprintendenza archeologica e per i beni ambientali, architettonici, artistici e storici del Molise, 1988. Vol. 4. P. 31–48. Ceglia V. Necropoli di Vicenne // Studi sull’Italia dei Sanniti. Milano: Electa, 2000. P. 298–302. Ceglia V. Presenze funerarie di eta altomedievale in Molise. Le necropoli di Campochiaro e la tomba del cavaliere // I Longobardi del Sud. Roma: Giorgio Bretschneider Editore, 2010. P. 241–255. Ceglia V. Tomba bisoma 88 della necropoli di Campochiaro, localita Morrione // Il futuro dei longobardi. L 'Italia e la costruzione dell' Europa di Carlo Magno / A cura di С. Bertelli, G.P. Brogiolo. Milano: Skira, 2000. P. 80–81. Ceglia V. Varietа di infl ussi culturali nelle necropoli di Campochiaro. Considerazioni preliminari / I beni culturali nel Molise. Il Medioevo / A cura di De Benedittis G. Campobasso: Istituto regionale per gli studi storici del Molise “V. Cuoco”, 2004. P. 79–86. Ceglia V., Genito B. La necropoli altomedievale di Vicenne a Campochiaro // Samnium: Archeologia del Molisе. Roma: Quasar, 1991. P. 329–334. Ceglia V., Marchetta I. Nuovi dati dalla necropoli di Vicenne a Campochiaro // La trasformazione del mondo romano e le grandi migrazioni. Nuovi popoli dall'Europa settentrionale e centro–orientale alle coste del Mediterraneo / A cura di C. Ebanista, M. Rotili. Napoli: Tavolario Edizioni, 2012. P. 217–238. Chronicarum quae dic*ntur Fredegarii Scholastici libri IV // MGH, Scriptores Rerum Merovingicarum / Ed. B. Krusch. Hannoverae: Impensis bibliopolii hahniani, 1888. T. 2. P. 1-193. Constitutiones et Acta Publica Imperatorum et Regum // MGH, Rerum Germanicarum Medii Aevi / Ed. L. Weiland. Hannoverae, Impensis bibliopolii hahniani, 1893. T. I, №. 333. P. 472–477. Curta F. Ethnicity in the Steppe Lands of the Northern Black Sea Region During The Early Byzantine Times // Archaeologia Bulgarica. 2019. T. ХХIII. P. 33–70. De Benedittis G. Di alcuni materiali altomedievali provenienti dal Molise centrale ed il problema topografi co della necropoli di Vicenne // Conoscenze. Campobasso: Soprintendenza archeologica e per i beni ambientali, architettonici, artistici e storici del Molise, 1988. Vol. 4. P. 103–108. De Benedittis G. Introduzione // Samnium: Archeologia del Molisе. Roma: Quasar, 1991. P. 325–328. De Marchi P.M. Modelli insediativi "militarizzati" d'eta longobarda in Lombardia // Citta, castelli, campagne nel territori di frontiera (secoli 6–7). Mantova: SAP Societa Archeologica S.r.l., 1995. P. 33–85. De Vingo P. Avari e slavi nel Friuli altomedievale secondo l’Historia Langobardorum di Paolo Diacono // Paolo Diacono e il Friuli alto medievale (secc. VI– X). Spoleto: Centro Italiano di studi sull’alto medioevo, 2001. P. 807–815. Ditten H. Protobulgaren und Germanen im 5.–7. Jahrhundert (vor der Grundung des ersten bulgarischen Reiches) // Bulgarian Historical Review. София: Институт за исторически изследвания, 1980. Vol. VIII, 3. P. 51–77. Donceva–Petkova L. Zur ethnischen Zugehörigkeit einiger Nekropolen des 11. Jahrhunderts in Bulgarien // Post–Roman Towns, Trade and Settlement in Europe and Byzantium / Ed. J. Henning. Berlin–New York: Walter de Gruyter, 2007. Vol. 2. S. 643–660. Ebanista C. Gli usi funerari nel ducato di Benevento: alcune considerazioni sulle necropoli campane e molisane di VI–VIII secolo // Archeologia e storia delle migrazioni: Europa, Italia, Mediterraneo fra tarda eta romana e alto medioevo (Giornate sulla tarda antichita e il medioevo, 3). Cimitile: Tavolario Edizioni, 2011. P. 337–364. Ebanista С. Tradizioni funerarie nel ducato di Benevento: l’apporto delle popolazioni alloctone // Nekropoli Longobarde in Italia. Atti del Convegno Internazionale 26–28.09.2011. Trento: Castello del Buonconsiglio, monumenti e collezioni provinciali, 2014. P. 445–471. Fedele A. La deposizione del cavallo nei cimiteri longobardi: dati e prime osservazioni // Archeologia dei Longobardi: dati e metodi per nuovi percorsi di analisi (Archeologia Barbarica, 1). Mantova: SAP Societa Archeologica s.r.l., 2017. P. 59–82. Fedele A., Marchetta I., Colombo D. Ritualita e rappresentazione funeraria nelle tombe di Vicenne (Campochiaro, CB). Una sintesi // Prima e dopo Alboino sulle trace dei Longobardi. Atti del Convegno internazionale di studi Cimitile–Nola–Santa Maria Capua Vetere. Cimitile: Guida, 2019. P. 295–314. Genito B. Archaeology of the Early medieval nomads in Italy: the horse–burials in Molise (7th century) south–central Italy // Kontakte zwischen Iran, Byzanz und der Steppe in 6.–7. Jh. / Hrsg. C. Balint (Varia Archaeologica Hungarica, IX). Budapest: Archaologisches Institut der UAW, 2000. P. 229–247. Genito B. Il Molise nell’altomedioevo: tra Mediterraneo ed Eurasia. Un’occasione perduta? // Miti e popoli del Mediterraneo antico. Scritti in onore di Gabriella d'Henry. Salerno: Tipografi a Fusco, 2014. P. 279–292. Genito B. Materiali e problemi // Conoscenze. Campobasso: Soprintendenza archeologica e per i beni ambientali, architettonici, artistici e storici del Molise, 1988. Vol. 4. P. 49–67. Genito B. Sepolture con cavallo da Vicenne (CB): un rituale nomadico di origine centroasiatica // I Congresso Nazionale di Archeologia Medievale (Pisa 29–31 maggio 1997) / A cura di S. Gelichi. Firenze: All'Insegna del Giglio, 1997. P. 286–289. Genito B. Tombe con cavallo a Vicenne // Samnium: Archeologia del Molisе. Roma: Quasar, 1991. P. 335–338. Giostra C. Il ducato longobardo di Ivrea: la grande necropoli di Borgomasino // Per il Museo di Ivrea. Lasezione archeologica del Museo Civico P.A. Garda / A cura di A. Gabucci, L. Pejrani Baricco, S. Ratto. Firenze: All’Insegna Giglio, 2014. P. 155–176. Hersak E. Vulgarum dux Alzeco // Casopis za zgodovino in narodopisje. Maribor: Izdajata univerza v Mariboru in Zgodovinsko drustvo v Mariboru, 2001. Let. 72 (37), 1–2. S. 269–278. Hodgkin T. Italy and her Invaders. Oxford: Clarendon Press, 1895. Vol. VI. 636 p. Jozsa L., Fothi E. Trepanalt koponyak a Karpat–medenceben (a leletek szambavetele, megoszlasa es lelohelyei) // Folia Anthropologica. Szombathely: Balogh es Tarsa Kft, 2007. T. 6. O. 5–18. Koch A. Uberlegungen zum Transfer von Schwerttrag– und –kampfesweise im fruhen Mittelalter am Beispiel chinesischer Schwerter mit p–förmigen Tragriemenhaltern aus dem 6.–8. Jahrhundert n. Chr. // Jahrbucher des Romisch–Germanischen Zentralmuseums. Mainz: RGZM, 1998. Bd. 45. S. 571–598. Kruger K.–H. Zur «beneventanischen» Konzeption der Langobardengeschichte des Paulus Diakonus // Fruhmittelalterliche studien. Berlin–New York: Walter de Gruyter, 1981. Bd. 15. P. 18–35. La Rocca C. Tombe con corredi, etnicita e prestigio sociale: l’Italia longobarda del VII secolo attraverso l’interpretazione archeologica // Archeologia e storia dei Longobardi in Trentino. Mezzolombardo: Comune di Mezzolombardo, 2009. P. 55–76. La Salvia V. La diffusione della staffa nell’area merovingia orientale alla luce delle fonti archeologiche // Temporis Signa. Spoleto: Fondazione Centro Italiano di studi sull’alto Medioevo, 2007. Vol. 2. P. 155–171. Laszlo O. Detailed Analysis of a Trepanation from the Late Avar Period (Turn of the 7th–8th Centuries—811) and Its Signifi cance in the Anthropological Material of the Carpathian Basin // International Journal of Osteoarchaeology. Published online in Wiley Online Library, 2016. Vol. 26–2. P. 359–365. Marchetta I. Ceramica ed Ethnos nelle tombe di Vicenne (Campochiaro, CB): il ritual funerario attraverso l’analisi del corredo vascolare // Le forme della crisi. Produzioni ceramiche e commerce nell’Italia centrale tra Romani e Longobardi (III–VIII sec. d.C.) / A cura di E. Cirelli, F. Diosono, H. Patterson. Bologna: Ante Quem, 2015. P. 663–671. Marchetta I. Il carattere composito del regno: le necropoli di Campochiaro (Campobasso) (cat. II.36–40) // Longobardi. Un popolo che cambia la storia. Schede mostra / A cura di G.P. Brogiolo, F. Marazzi, C. Giostra. Milano, Skira, 2017. P. 54–58. Mednikova M.B. Prehistoric Trepanations in Russia: Ritual or Surgical? // Trepanation: History, Discovery, Theory / Eds. R. Arnott, S. Finger, S. Smith C. Lisse: Swets & Zeitlinger, 2003. P. 163–174. Muratori L.A. Antiquitates Italicae medii Aevi, sive Dissertationes. Mediolani: Ex Typographia societatis Palatinae, 1740. T. III. 1242 coll.Pasqui U. Documenti per la storia della citta di Arezzo nel medio evo. Arezzo: G.P. Vieusseux, 1899. Vol. I. 576 p. Pauli historia Langohardorum // MGH. Scriptores rerum Langobardicarum et Italicarum saec. VI–IX / Ed. G. Waitz. Hannoverae: Impensis bibliopolii hahniani, 1878. Bd. I. P. 12–187. Pieri S. Toponomastica della Toscana meridionale (valli della Fiora, dell ‘Ombrone, della Cecina e fi umi minori) e dell‘Arcipelago Toscano. Siena: Accademia senese degli intronati, 1969. 472 p. Pohl W. Die Awaren. Ein Steppenvolk im Mittelalter. 567–822. Munchen: Verlag C.H. Beck, 1988. 529 p. Polverari A. Una Bulgaria nella Pentapoli. Longobardi, Bulgari e Sclavini a Senigallia. Senigallia: Pierfederici, 1969. 41 p. Premuzic Z., Rajic Sikanjic P., Rapan Papesa A. A case of Avar period trepanation from Croatia // Anthropological Review. Published online by De Gruyter, 2016. Vol. 79 (4). P. 471–482. Provesi C. Cavalli e cavalieri in Italia nell'Alto Medioevo (secc. V–X): studio della simbologia equestre attraverso fonti narrative, documentarie e archeologiche. Tesi di Dottorato. Venezia, 2013. Provesi C. I cavalieri e le loro donne, uno studio dei corredi funerari di VI–VII secolo // Univ. Degli studi di Verona. Verona, 2013. Доступно по URL: https://www.yumpu.com/it/document/view/16247410/chiara–provesi–scuola–superiore–di–studi–storici–geografi ci–(Дата обращения 04.12.2020) Provesi C. Uomini e cavalli in Italia meridionale da Cassiodoro ad Alzecone // Ipsam Nolam barbari vastaverunt: l’Italia e il Mediterraneo occidentale tra il V secolo e la metа del VI. Cimitile: Tavolario Edizioni, 2010. P. 97–111. Repetti E. Dizionario geografi co fi sico storico della Toscana. Firenze: Presso L’autore e editore, 1833. Vol. 1. 846 p. Rotili M. I Longobardi migrazioni, etnogenesi, insediamento // I Longobardi del Sud. Roma: Giorgio Bretschneider Editore, 2010. P. 1–77. Rubini M, Zaio P. Warriors from the East. Skeletal evidence of warfare from a Lombard–Avar cemetery in Central Italy (Campochiaro, Molise, 6th–8th Century AD) // Journal of Archaeological Science. Published online by Elsevier, 2011. Vol. 38. Issue 7. P. 1551–1559. Rubini M. Gli Avari in Molise. La necropoli di Campochiaro Morrione // ArcheoMolise. Associazione culturale ArcheoIdea. Isernia: Associazione culturale ArcheoIdea, 2009. T. II (apr.–giu. 2009). Р. 17–25. Rubini M. Il popolamento del Molise durante l’alto medioevo // I beni culturali nel Molise. Il Medioevo / A cura di De Benedittis G. Campobasso: Istituto regionale per gli studi storici del Molise “V. Cuoco”, 2004. P. 151–162. Sabatini F. Rifl essi linguistici della dominazione longobarda nell’Italia mediana e meridionale // Aristocrazie e societa fra transizione romano–germanica e alto medioevo. San Vitaliano: Tavolario Edizioni, 2015. P. 353–441. Sarno E. Campobasso da castrum a citta murattiana. Roma: Aracne, 2012. 324 p. Schneider F. Regestum Volaterranum. Regesten der Urkunden von Volterra (778–1303). Roma: Ermanno Loescher, 1907. 448 p. Staffa A.R. Una terra di frontiera: Abruzzo e Molise fra VI e VII Secolo // Citta, castelli, campagne nei territori di frontiera (secoli VI–VII) / A cura di G.P. Brogiolo. Мantova: Padus, 1995. P. 187–238. Staffa A.R. Bizantini e Longobardi fra Abruzzo e Molise (secc. VI–VII) / I beni culturali nel Molise. Il Medioevo / A cura di De Benedittis G. Campobasso: Istituto regionale per gli studi storici del Molise “V. Cuoco”, 2004. P. 215–248. Tomka P. Die Bestattungsformen der Awaren // Hunnen und Awaren. Reitervolker aus dem Osten. Burgenlandische Landesausstellung 1996 Schloss Halbturn vom 26. April bis 31. Oktober 1996. Begleitbuch und Katalog / Ed. F. Daim. Eisenstadt: Burgenland, Landesregierung, 1996. S. 384–387. Tornesi M. Presenze alloctone nell’Italia centrale: tempi, modalita e forme dell’organizzazione territorial nell’Abruzzo altomediale. Tesi di Dottorato. Roma: Sapienza universita’ di Roma, 2012. 275 p. Valenti M. Villaggi nell’eta delle migrazioni // I Longobardi. Dalla caduta dell’Impero all’alba dell’Italia / A cura di G.P. Brogiolo, A. Chavarria Arnau. Catalogo della mostra (Torino 28 settembre 2007–6 gennaio 2008). Milano: Silvana Editoriale, 2007. P. 151–158. Villa L. Il Friuli longobardo е gli Avari // L'oro degli Avari. Popolo delle steppe in Europa. Milano: Inform, 2000. P. 187–189. Wattenbach W. Deutschlands Geschichtsquellen im Mittelalter. Berlin: Verlag von Wilhelm Hertz, 1858. Vol. I. 478 p. Wattenbach W., Levison W., Lowe H. Deutschlands Geschichtsquellen im Mittelalter. Vorzeit und Karolinger. Weimar: Hermann Bohlaus nachfolger, 1953, Heft II. P. 157–290.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Education in Oceania continues to reflect the embedded implicit and explicit colonial practices and processes from the past. This paper conceptualises a cultural approach to education and leadership appropriate and relevant to the Republic of the Marshall Islands. As elementary school leaders, we highlight Kanne Lobal, a traditional Marshallese navigation practice based on indigenous language, values and practices. We conceptualise and develop Kanne Lobal in this paper as a framework for understanding the usefulness of our indigenous knowledge in leadership and educational practices within formal education. Through bwebwenato, a method of talk story, our key learnings and reflexivities were captured. We argue that realising the value of Marshallese indigenous knowledge and practices for school leaders requires purposeful training of the ways in which our knowledge can be made useful in our professional educational responsibilities. Drawing from our Marshallese knowledge is an intentional effort to inspire, empower and express what education and leadership partnership means for Marshallese people, as articulated by Marshallese themselves. Introduction As noted in the call for papers within the Waikato Journal of Education (WJE) for this special issue, bodies of knowledge and histories in Oceania have long sustained generations across geographic boundaries to ensure cultural survival. For Marshallese people, we cannot really know ourselves “until we know how we came to be where we are today” (Walsh, Heine, Bigler & Stege, 2012). Jitdam Kapeel is a popular Marshallese concept and ideal associated with inquiring into relationships within the family and community. In a similar way, the practice of relating is about connecting the present and future to the past. Education and leadership partnerships are linked and we look back to the past, our history, to make sense and feel inspired to transform practices that will benefit our people. In this paper and in light of our next generation, we reconnect with our navigation stories to inspire and empower education and leadership. Kanne lobal is part of our navigation stories, a conceptual framework centred on cultural practices, values, and concepts that embrace collective partnerships. Our link to this talanoa vā with others in the special issue is to attempt to make sense of connections given the global COVID-19 context by providing a Marshallese approach to address the physical and relational “distance” between education and leadership partnerships in Oceania. Like the majority of developing small island nations in Oceania, the Republic of the Marshall Islands (RMI) has had its share of educational challenges through colonial legacies of the past which continues to drive education systems in the region (Heine, 2002). The historical administration and education in the RMI is one of colonisation. Successive administrations by the Spanish, German, Japanese, and now the US, has resulted in education and learning that privileges western knowledge and forms of learning. This paper foregrounds understandings of education and learning as told by the voices of elementary school leaders from the RMI. The move to re-think education and leadership from Marshallese perspectives is an act of shifting the focus of bwebwenato or conversations that centres on Marshallese language and worldviews. The concept of jelalokjen was conceptualised as traditional education framed mainly within the community context. In the past, jelalokjen was practiced and transmitted to the younger generation for cultural continuity. During the arrival of colonial administrations into the RMI, jelalokjen was likened to the western notions of education and schooling (Kupferman, 2004). Today, the primary function of jelalokjen, as traditional and formal education, it is for “survival in a hostile [and challenging] environment” (Kupferman, 2004, p. 43). Because western approaches to learning in the RMI have not always resulted in positive outcomes for those engaged within the education system, as school leaders who value our cultural knowledge and practices, and aspire to maintain our language with the next generation, we turn to Kanne Lobal, a practice embedded in our navigation stories, collective aspirations, and leadership. The significance in the development of Kanne Lobal, as an appropriate framework for education and leadership, resulted in us coming together and working together. Not only were we able to share our leadership concerns, however, the engagement strengthened our connections with each other as school leaders, our communities, and the Public Schooling System (PSS). Prior to that, many of us were in competition for resources. Educational Leadership: IQBE and GCSL Leadership is a valued practice in the RMI. Before the IQBE programme started in 2018, the majority of the school leaders on the main island of Majuro had not engaged in collaborative partnerships with each other before. Our main educational purpose was to achieve accreditation from the Western Association of Schools and Colleges (WASC), an accreditation commission for schools in the United States. The WASC accreditation dictated our work and relationships and many school leaders on Majuro felt the pressure of competition against each other. We, the authors in this paper, share our collective bwebwenato, highlighting our school leadership experiences and how we gained strength from our own ancestral knowledge to empower “us”, to collaborate with each other, our teachers, communities, as well as with PSS; a collaborative partnership we had not realised in the past. The paucity of literature that captures Kajin Majol (Marshallese language) and education in general in the RMI is what we intend to fill by sharing our reflections and experiences. To move our educational practices forward we highlight Kanne Lobal, a cultural approach that focuses on our strengths, collective social responsibilities and wellbeing. For a long time, there was no formal training in place for elementary school leaders. School principals and vice principals were appointed primarily on their academic merit through having an undergraduate qualification. As part of the first cohort of fifteen school leaders, we engaged in the professional training programme, the Graduate Certificate in School Leadership (GCSL), refitted to our context after its initial development in the Solomon Islands. GCSL was coordinated by the Institute of Education (IOE) at the University of the South Pacific (USP). GCSL was seen as a relevant and appropriate training programme for school leaders in the RMI as part of an Asia Development Bank (ADB) funded programme which aimed at “Improving Quality Basic Education” (IQBE) in parts of the northern Pacific. GCSL was managed on Majuro, RMI’s main island, by the director at the time Dr Irene Taafaki, coordinator Yolanda McKay, and administrators at the University of the South Pacific’s (USP) RMI campus. Through the provision of GCSL, as school leaders we were encouraged to re-think and draw-from our own cultural repository and connect to our ancestral knowledge that have always provided strength for us. This kind of thinking and practice was encouraged by our educational leaders (Heine, 2002). We argue that a culturally-affirming and culturally-contextual framework that reflects the lived experiences of Marshallese people is much needed and enables the disruption of inherent colonial processes left behind by Western and Eastern administrations which have influenced our education system in the RMI (Heine, 2002). Kanne Lobal, an approach utilising a traditional navigation has warranted its need to provide solutions for today’s educational challenges for us in the RMI. Education in the Pacific Education in the Pacific cannot be understood without contextualising it in its history and culture. It is the same for us in the RMI (Heine, 2002; Walsh et al., 2012). The RMI is located in the Pacific Ocean and is part of Micronesia. It was named after a British captain, John Marshall in the 1700s. The atolls in the RMI were explored by the Spanish in the 16th century. Germany unsuccessfully attempted to colonize the islands in 1885. Japan took control in 1914, but after several battles during World War II, the US seized the RMI from them. In 1947, the United Nations made the island group, along with the Mariana and Caroline archipelagos, a U.S. trust territory (Walsh et al, 2012). Education in the RMI reflects the colonial administrations of Germany, Japan, and now the US. Before the turn of the century, formal education in the Pacific reflected western values, practices, and standards. Prior to that, education was informal and not binded to formal learning institutions (Thaman, 1997) and oral traditions was used as the medium for transmitting learning about customs and practices living with parents, grandparents, great grandparents. As alluded to by Jiba B. Kabua (2004), any “discussion about education is necessarily a discussion of culture, and any policy on education is also a policy of culture” (p. 181). It is impossible to promote one without the other, and it is not logical to understand one without the other. Re-thinking how education should look like, the pedagogical strategies that are relevant in our classrooms, the ways to engage with our parents and communities - such re-thinking sits within our cultural approaches and frameworks. Our collective attempts to provide a cultural framework that is relevant and appropriate for education in our context, sits within the political endeavour to decolonize. This means that what we are providing will not only be useful, but it can be used as a tool to question and identify whether things in place restrict and prevent our culture or whether they promote and foreground cultural ideas and concepts, a significant discussion of culture linked to education (Kabua, 2004). Donor funded development aid programmes were provided to support the challenges within education systems. Concerned with the persistent low educational outcomes of Pacific students, despite the prevalence of aid programmes in the region, in 2000 Pacific educators and leaders with support from New Zealand Aid (NZ Aid) decided to intervene (Heine, 2002; Taufe’ulungaki, 2014). In April 2001, a group of Pacific educators and leaders across the region were invited to a colloquium funded by the New Zealand Overseas Development Agency held in Suva Fiji at the University of the South Pacific. The main purpose of the colloquium was to enable “Pacific educators to re-think the values, assumptions and beliefs underlying [formal] schooling in Oceania” (Benson, 2002). Leadership, in general, is a valued practice in the RMI (Heine, 2002). Despite education leadership being identified as a significant factor in school improvement (Sanga & Chu, 2009), the limited formal training opportunities of school principals in the region was a persistent concern. As part of an Asia Development Bank (ADB) funded project, the Improve Quality Basic Education (IQBE) intervention was developed and implemented in the RMI in 2017. Mentoring is a process associated with the continuity and sustainability of leadership knowledge and practices (Sanga & Chu, 2009). It is a key aspect of building capacity and capabilities within human resources in education (ibid). Indigenous knowledges and education research According to Hilda Heine, the relationship between education and leadership is about understanding Marshallese history and culture (cited in Walsh et al., 2012). It is about sharing indigenous knowledge and histories that “details for future generations a story of survival and resilience and the pride we possess as a people” (Heine, cited in Walsh et al., 2012, p. v). This paper is fuelled by postcolonial aspirations yet is grounded in Pacific indigenous research. This means that our intentions are driven by postcolonial pursuits and discourses linked to challenging the colonial systems and schooling in the Pacific region that privileges western knowledge and learning and marginalises the education practices and processes of local people (Thiong’o, 1986). A point of difference and orientation from postcolonialism is a desire to foreground indigenous Pacific language, specifically Majin Majol, through Marshallese concepts. Our collective bwebwenato and conversation honours and values kautiej (respect), jouj eo mour eo (reciprocity), and jouj (kindness) (Taafaki & Fowler, 2019). Pacific leaders developed the Rethinking Pacific Education Initiative for and by Pacific People (RPEIPP) in 2002 to take control of the ways in which education research was conducted by donor funded organisations (Taufe’ulungaki, 2014). Our former president, Dr Hilda Heine was part of the group of leaders who sought to counter the ways in which our educational and leadership stories were controlled and told by non-Marshallese (Heine, 2002). As a former minister of education in the RMI, Hilda Heine continues to inspire and encourage the next generation of educators, school leaders, and researchers to re-think and de-construct the way learning and education is conceptualised for Marshallese people. The conceptualisation of Kanne Lobal acknowledges its origin, grounded in Marshallese navigation knowledge and practice. Our decision to unpack and deconstruct Kanne Lobal within the context of formal education and leadership responds to the need to not only draw from indigenous Marshallese ideas and practice but to consider that the next generation will continue to be educated using western processes and initiatives particularly from the US where we get a lot of our funding from. According to indigenous researchers Dawn Bessarab and Bridget Ng’andu (2010), doing research that considers “culturally appropriate processes to engage with indigenous groups and individuals is particularly pertinent in today’s research environment” (p. 37). Pacific indigenous educators and researchers have turned to their own ancestral knowledge and practices for inspiration and empowerment. Within western research contexts, the often stringent ideals and processes are not always encouraging of indigenous methods and practices. However, many were able to ground and articulate their use of indigenous methods as being relevant and appropriate to capturing the realities of their communities (Nabobo-Baba, 2008; Sualii-Sauni & Fulu-Aiolupotea, 2014; Thaman, 1997). At the same time, utilising Pacific indigenous methods and approaches enabled research engagement with their communities that honoured and respected them and their communities. For example, Tongan, Samoan, and Fijian researchers used the talanoa method as a way to capture the stories, lived realities, and worldviews of their communities within education in the diaspora (Fa’avae, Jones, & Manu’atu, 2016; Nabobo-Baba, 2008; Sualii-Sauni & Aiolupotea, 2014; Vaioleti, 2005). Tok stori was used by Solomon Islander educators and school leaders to highlight the unique circles of conversational practice and storytelling that leads to more positive engagement with their community members, capturing rich and meaningful narratives as a result (Sanga & Houma, 2004). The Indigenous Aborigine in Australia utilise yarning as a “relaxed discussion through which both the researcher and participant journey together visiting places and topics of interest relevant” (Bessarab & Ng’andu, 2010, p. 38). Despite the diverse forms of discussions and storytelling by indigenous peoples, of significance are the cultural protocols, ethics, and language for conducting and guiding the engagement (Bessarab & Ng’andu, 2010; Nabobo-Baba, 2008; Sualii-Sauni & Aiolupotea, 2014). Through the ethics, values, protocols, and language, these are what makes indigenous methods or frameworks unique compared to western methods like in-depth interviews or semi-structured interviews. This is why it is important for us as Marshallese educators to frame, ground, and articulate how our own methods and frameworks of learning could be realised in western education (Heine, 2002; Jetnil-Kijiner, 2014). In this paper, we utilise bwebwenato as an appropriate method linked to “talk story”, capturing our collective stories and experiences during GCSL and how we sought to build partnerships and collaboration with each other, our communities, and the PSS. Bwebwenato and drawing from Kajin Majel Legends and stories that reflect Marshallese society and its cultural values have survived through our oral traditions. The practice of weaving also holds knowledge about our “valuable and earliest sources of knowledge” (Taafaki & Fowler, 2019, p. 2). The skilful navigation of Marshallese wayfarers on the walap (large canoes) in the ocean is testament of their leadership and the value they place on ensuring the survival and continuity of Marshallese people (Taafaki & Fowler, 2019; Walsh et al., 2012). During her graduate study in 2014, Kathy Jetnil-Kijiner conceptualised bwebwenato as being the most “well-known form of Marshallese orality” (p. 38). The Marshallese-English dictionary defined bwebwenato as talk, conversation, story, history, article, episode, lore, myth, or tale (cited in Jetnil Kijiner, 2014). Three years later in 2017, bwebwenato was utilised in a doctoral project by Natalie Nimmer as a research method to gather “talk stories” about the experiences of 10 Marshallese experts in knowledge and skills ranging from sewing to linguistics, canoe-making and business. Our collective bwebwenato in this paper centres on Marshallese ideas and language. The philosophy of Marshallese knowledge is rooted in our “Kajin Majel”, or Marshallese language and is shared and transmitted through our oral traditions. For instance, through our historical stories and myths. Marshallese philosophy, that is, the knowledge systems inherent in our beliefs, values, customs, and practices are shared. They are inherently relational, meaning that knowledge systems and philosophies within our world are connected, in mind, body, and spirit (Jetnil-Kijiner, 2014; Nimmer, 2017). Although some Marshallese believe that our knowledge is disappearing as more and more elders pass away, it is therefore important work together, and learn from each other about the knowledges shared not only by the living but through their lamentations and stories of those who are no longer with us (Jetnil-Kijiner, 2014). As a Marshallese practice, weaving has been passed-down from generation to generation. Although the art of weaving is no longer as common as it used to be, the artefacts such as the “jaki-ed” (clothing mats) continue to embody significant Marshallese values and traditions. For our weavers, the jouj (check spelling) is the centre of the mat and it is where the weaving starts. When the jouj is correct and weaved well, the remainder and every other part of the mat will be right. The jouj is symbolic of the “heart” and if the heart is prepared well, trained well, then life or all other parts of the body will be well (Taafaki & Fowler, 2019). In that light, we have applied the same to this paper. Conceptualising and drawing from cultural practices that are close and dear to our hearts embodies a significant ontological attempt to prioritize our own knowledge and language, a sense of endearment to who we are and what we believe education to be like for us and the next generation. The application of the phrase “Majolizing '' was used by the Ministry of Education when Hilda Heine was minister, to weave cultural ideas and language into the way that teachers understand the curriculum, develop lesson plans and execute them in the classroom. Despite this, there were still concerns with the embedded colonized practices where teachers defaulted to eurocentric methods of doing things, like the strategies provided in the textbooks given to us. In some ways, our education was slow to adjust to the “Majolizing '' intention by our former minister. In this paper, we provide Kanne Lobal as a way to contribute to the “Majolizing intention” and perhaps speed up yet still be collectively responsible to all involved in education. Kajin Wa and Kanne Lobal “Wa” is the Marshallese concept for canoe. Kajin wa, as in canoe language, has a lot of symbolic meaning linked to deeply-held Marshallese values and practices. The canoe was the foundational practice that supported the livelihood of harsh atoll island living which reflects the Marshallese social world. The experts of Kajin wa often refer to “wa” as being the vessel of life, a means and source of sustaining life (Kelen, 2009, cited in Miller, 2010). “Jouj” means kindness and is the lower part of the main hull of the canoe. It is often referred to by some canoe builders in the RMI as the heart of the canoe and is linked to love. The jouj is one of the first parts of the canoe that is built and is “used to do all other measurements, and then the rest of the canoe is built on top of it” (Miller, 2010, p. 67). The significance of the jouj is that when the canoe is in the water, the jouj is the part of the hull that is underwater and ensures that all the cargo and passengers are safe. For Marshallese, jouj or kindness is what living is about and is associated with selflessly carrying the responsibility of keeping the family and community safe. The parts of the canoe reflect Marshallese culture, legend, family, lineage, and kinship. They embody social responsibilities that guide, direct, and sustain Marshallese families’ wellbeing, from atoll to atoll. For example, the rojak (boom), rojak maan (upper boom), rojak kōrā (lower boom), and they support the edges of the ujelā/ujele (sail) (see figure 1). The literal meaning of rojak maan is male boom and rojak kōrā means female boom which together strengthens the sail and ensures the canoe propels forward in a strong yet safe way. Figuratively, the rojak maan and rojak kōrā symbolise the mother and father relationship which when strong, through the jouj (kindness and love), it can strengthen families and sustain them into the future. Figure 1. Parts of the canoe Source: https://www.canoesmarshallislands.com/2014/09/names-of-canoe-parts/ From a socio-cultural, communal, and leadership view, the canoe (wa) provides understanding of the relationships required to inspire and sustain Marshallese peoples’ education and learning. We draw from Kajin wa because they provide cultural ideas and practices that enable understanding of education and leadership necessary for sustaining Marshallese people and realities in Oceania. When building a canoe, the women are tasked with the weaving of the ujelā/ujele (sail) and to ensure that it is strong enough to withstand long journeys and the fierce winds and waters of the ocean. The Kanne Lobal relates to the front part of the ujelā/ujele (sail) where the rojak maan and rojak kōrā meet and connect (see the red lines in figure 1). Kanne Lobal is linked to the strategic use of the ujelā/ujele by navigators, when there is no wind north wind to propel them forward, to find ways to capture the winds so that their journey can continue. As a proverbial saying, Kanne Lobal is used to ignite thinking and inspire and transform practice particularly when the journey is rough and tough. In this paper we draw from Kanne Lobal to ignite, inspire, and transform our educational and leadership practices, a move to explore what has always been meaningful to Marshallese people when we are faced with challenges. The Kanne Lobal utilises our language, and cultural practices and values by sourcing from the concepts of jouj (kindness, love), kautiej (respect), and jouj eo mour eo (reciprocity). A key Marshallese proverb, “Enra bwe jen lale rara”, is the cultural practice where families enact compassion through the sharing of food in all occurrences. The term “enra” is a small basket weaved from the coconut leaves, and often used by Marshallese as a plate to share and distribute food amongst each other. Bwe-jen-lale-rara is about noticing and providing for the needs of others, and “enra” the basket will help support and provide for all that are in need. “Enra-bwe-jen-lale-rara” is symbolic of cultural exchange and reciprocity and the cultural values associated with building and maintaining relationships, and constantly honouring each other. As a Marshallese practice, in this article we share our understanding and knowledge about the challenges as well as possible solutions for education concerns in our nation. In addition, we highlight another proverb, “wa kuk wa jimor”, which relates to having one canoe, and despite its capacity to feed and provide for the individual, but within the canoe all people can benefit from what it can provide. In the same way, we provide in this paper a cultural framework that will enable all educators to benefit from. It is a framework that is far-reaching and relevant to the lived realities of Marshallese people today. Kumit relates to people united to build strength, all co-operating and working together, living in peace, harmony, and good health. Kanne Lobal: conceptual framework for education and leadership An education framework is a conceptual structure that can be used to capture ideas and thinking related to aspects of learning. Kanne Lobal is conceptualised and framed in this paper as an educational framework. Kanne Lobal highlights the significance of education as a collective partnership whereby leadership is an important aspect. Kanne Lobal draws-from indigenous Marshallese concepts like kautiej (respect), jouj eo mour eo (reciprocity), and jouj (kindness, heart). The role of a leader, including an education leader, is to prioritise collective learning and partnerships that benefits Marshallese people and the continuity and survival of the next generation (Heine, 2002; Thaman, 1995). As described by Ejnar Aerōk, an expert canoe builder in the RMI, he stated: “jerbal ippān doon bwe en maron maan wa e” (cited in Miller, 2010, p. 69). His description emphasises the significance of partnerships and working together when navigating and journeying together in order to move the canoe forward. The kubaak, the outrigger of the wa (canoe) is about “partnerships”. For us as elementary school leaders on Majuro, kubaak encourages us to value collaborative partnerships with each other as well as our communities, PSS, and other stakeholders. Partnerships is an important part of the Kanne Lobal education and leadership framework. It requires ongoing bwebwenato – the inspiring as well as confronting and challenging conversations that should be mediated and negotiated if we and our education stakeholders are to journey together to ensure that the educational services we provide benefits our next generation of young people in the RMI. Navigating ahead the partnerships, mediation, and negotiation are the core values of jouj (kindness, love), kautiej (respect), and jouj eo mour eo (reciprocity). As an organic conceptual framework grounded in indigenous values, inspired through our lived experiences, Kanne Lobal provides ideas and concepts for re-thinking education and leadership practices that are conducive to learning and teaching in the schooling context in the RMI. By no means does it provide the solution to the education ills in our nation. However, we argue that Kanne Lobal is a more relevant approach which is much needed for the negatively stigmatised system as a consequence of the various colonial administrations that have and continue to shape and reframe our ideas about what education should be like for us in the RMI. Moreover, Kannel Lobal is our attempt to decolonize the framing of education and leadership, moving our bwebwenato to re-framing conversations of teaching and learning so that our cultural knowledge and values are foregrounded, appreciated, and realised within our education system. Bwebwenato: sharing our stories In this section, we use bwebwenato as a method of gathering and capturing our stories as data. Below we capture our stories and ongoing conversations about the richness in Marshallese cultural knowledge in the outer islands and on Majuro and the potentialities in Kanne Lobal. Danny Jim When I was in third grade (9-10 years of age), during my grandfather’s speech in Arno, an atoll near Majuro, during a time when a wa (canoe) was being blessed and ready to put the canoe into the ocean. My grandfather told me the canoe was a blessing for the family. “Without a canoe, a family cannot provide for them”, he said. The canoe allows for travelling between places to gather food and other sources to provide for the family. My grandfather’s stories about people’s roles within the canoe reminded me that everyone within the family has a responsibility to each other. Our women, mothers and daughters too have a significant responsibility in the journey, in fact, they hold us, care for us, and given strength to their husbands, brothers, and sons. The wise man or elder sits in the middle of the canoe, directing the young man who help to steer. The young man, he does all the work, directed by the older man. They take advice and seek the wisdom of the elder. In front of the canoe, a young boy is placed there and because of his strong and youthful vision, he is able to help the elder as well as the young man on the canoe. The story can be linked to the roles that school leaders, teachers, and students have in schooling. Without each person knowing intricately their role and responsibility, the sight and vision ahead for the collective aspirations of the school and the community is difficult to comprehend. For me, the canoe is symbolic of our educational journey within our education system. As the school leader, a central, trusted, and respected figure in the school, they provide support for teachers who are at the helm, pedagogically striving to provide for their students. For without strong direction from the school leaders and teachers at the helm, the students, like the young boy, cannot foresee their futures, or envisage how education can benefit them. This is why Kanne Lobal is a significant framework for us in the Marshall Islands because within the practice we are able to take heed and empower each other so that all benefit from the process. Kanne Lobal is linked to our culture, an essential part of who we are. We must rely on our own local approaches, rather than relying on others that are not relevant to what we know and how we live in today’s society. One of the things I can tell is that in Majuro, compared to the outer islands, it’s different. In the outer islands, parents bring children together and tell them legends and stories. The elders tell them about the legends and stories – the bwebwenato. Children from outer islands know a lot more about Marshallese legends compared to children from the Majuro atoll. They usually stay close to their parents, observe how to prepare food and all types of Marshallese skills. Loretta Joseph Case There is little Western influence in the outer islands. They grow up learning their own culture with their parents, not having tv. They are closely knit, making their own food, learning to weave. They use fire for cooking food. They are more connected because there are few of them, doing their own culture. For example, if they’re building a house, the ladies will come together and make food to take to the males that are building the house, encouraging them to keep on working - “jemjem maal” (sharpening tools i.e. axe, like encouraging workers to empower them). It’s when they bring food and entertainment. Rubon Rubon Togetherness, work together, sharing of food, these are important practices as a school leader. Jemjem maal – the whole village works together, men working and the women encourage them with food and entertainment. All the young children are involved in all of the cultural practices, cultural transmission is consistently part of their everyday life. These are stronger in the outer islands. Kanne Lobal has the potential to provide solutions using our own knowledge and practices. Connie Joel When new teachers become a teacher, they learn more about their culture in teaching. Teaching raises the question, who are we? A popular saying amongst our people, “Aelon kein ad ej aelon in manit”, means that “Our islands are cultural islands”. Therefore, when we are teaching, and managing the school, we must do this culturally. When we live and breathe, we must do this culturally. There is more socialising with family and extended family. Respect the elderly. When they’re doing things the ladies all get together, in groups and do it. Cut the breadfruit, and preserve the breadfruit and pandanus. They come together and do it. Same as fishing, building houses, building canoes. They use and speak the language often spoken by the older people. There are words that people in the outer islands use and understand language regularly applied by the elderly. Respect elderly and leaders more i.e., chiefs (iroj), commoners (alap), and the workers on the land (ri-jerbal) (social layer under the commoners). All the kids, they gather with their families, and go and visit the chiefs and alap, and take gifts from their land, first produce/food from the plantation (eojōk). Tommy Almet The people are more connected to the culture in the outer islands because they help one another. They don’t have to always buy things by themselves, everyone contributes to the occasion. For instance, for birthdays, boys go fishing, others contribute and all share with everyone. Kanne Lobal is a practice that can bring people together – leaders, teachers, stakeholders. We want our colleagues to keep strong and work together to fix problems like students and teachers’ absenteeism which is a big problem for us in schools. Demetria Malachi The culture in the outer islands are more accessible and exposed to children. In Majuro, there is a mixedness of cultures and knowledges, influenced by Western thinking and practices. Kanne Lobal is an idea that can enhance quality educational purposes for the RMI. We, the school leaders who did GCSL, we want to merge and use this idea because it will help benefit students’ learning and teachers’ teaching. Kanne Lobal will help students to learn and teachers to teach though traditional skills and knowledge. We want to revitalize our ways of life through teaching because it is slowly fading away. Also, we want to have our own Marshallese learning process because it is in our own language making it easier to use and understand. Essentially, we want to proudly use our own ways of teaching from our ancestors showing the appreciation and blessings given to us. Way Forward To think of ways forward is about reflecting on the past and current learnings. Instead of a traditional discussion within a research publication, we have opted to continue our bwebwenato by sharing what we have learnt through the Graduate Certificate in School Leadership (GCSL) programme. Our bwebwenato does not end in this article and this opportunity to collaborate and partner together in this piece of writing has been a meaningful experience to conceptualise and unpack the Kanne Lobal framework. Our collaborative bwebwenato has enabled us to dig deep into our own wise knowledges for guidance through mediating and negotiating the challenges in education and leadership (Sanga & Houma, 2004). For example, bwe-jen-lale-rara reminds us to inquire, pay attention, and focus on supporting the needs of others. Through enra-bwe-jen-lale-rara, it reminds us to value cultural exchange and reciprocity which will strengthen the development and maintaining of relationships based on ways we continue to honour each other (Nimmer, 2017). We not only continue to support each other, but also help mentor the next generation of school leaders within our education system (Heine, 2002). Education and leadership are all about collaborative partnerships (Sanga & Chu, 2009; Thaman, 1997). Developing partnerships through the GCSL was useful learning for us. It encouraged us to work together, share knowledge, respect each other, and be kind. The values of jouj (kindness, love), kautiej (respect), and jouj eo mour eo (reciprocity) are meaningful in being and becoming and educational leader in the RMI (Jetnil-Kijiner, 2014; Miller, 2010; Nimmer, 2017). These values are meaningful for us practice particularly given the drive by PSS for schools to become accredited. The workshops and meetings delivered during the GCSL in the RMI from 2018 to 2019 about Kanne Lobal has given us strength to share our stories and experiences from the meeting with the stakeholders. But before we met with the stakeholders, we were encouraged to share and speak in our language within our courses: EDP05 (Professional Development and Learning), EDP06 (School Leadership), EDP07 (School Management), EDP08 (Teaching and Learning), and EDP09 (Community Partnerships). In groups, we shared our presentations with our peers, the 15 school leaders in the GCSL programme. We also invited USP RMI staff. They liked the way we presented Kannel Lobal. They provided us with feedback, for example: how the use of the sail on the canoe, the parts and their functions can be conceptualised in education and how they are related to the way that we teach our own young people. Engaging stakeholders in the conceptualisation and design stages of Kanne Lobal strengthened our understanding of leadership and collaborative partnerships. Based on various meetings with the RMI Pacific Resources for Education and Learning (PREL) team, PSS general assembly, teachers from the outer islands, and the PSS executive committee, we were able to share and receive feedback on the Kanne Lobal framework. The coordinators of the PREL programme in the RMI were excited by the possibilities around using Kanne Lobal, as a way to teach culture in an inspirational way to Marshallese students. Our Marshallese knowledge, particularly through the proverbial meaning of Kanne Lobal provided so much inspiration and insight for the groups during the presentation which gave us hope and confidence to develop the framework. Kanne Lobal is an organic and indigenous approach, grounded in Marshallese ways of doing things (Heine, 2002; Taafaki & Fowler, 2019). Given the persistent presence of colonial processes within the education system and the constant reference to practices and initiatives from the US, Kanne Lobal for us provides a refreshing yet fulfilling experience and makes us feel warm inside because it is something that belongs to all Marshallese people. Conclusion Marshallese indigenous knowledge and practices provide meaningful educational and leadership understanding and learnings. They ignite, inspire, and transform thinking and practice. The Kanne Lobal conceptual framework emphasises key concepts and values necessary for collaborative partnerships within education and leadership practices in the RMI. The bwebwenato or talk stories have been insightful and have highlighted the strengths and benefits that our Marshallese ideas and practices possess when looking for appropriate and relevant ways to understand education and leadership. Acknowledgements We want to acknowledge our GCSL cohort of school leaders who have supported us in the development of Kanne Lobal as a conceptual framework. A huge kommol tata to our friends: Joana, Rosana, Loretta, Jellan, Alvin, Ellice, Rolando, Stephen, and Alan. References Benson, C. (2002). Preface. In F. Pene, A. M. Taufe’ulungaki, & C. Benson (Eds.), Tree of Opportunity: re-thinking Pacific Education (p. iv). Suva, Fiji: University of the South Pacific, Institute of Education. Bessarab, D., Ng’andu, B. (2010). Yarning about yarning as a legitimate method in indigenous research. International Journal of Critical Indigenous Studies, 3(1), 37-50. Fa’avae, D., Jones, A., & Manu’atu, L. (2016). Talanoa’i ‘a e talanoa - talking about talanoa: Some dilemmas of a novice researcher. AlterNative: An Indigenous Journal of Indigenous Peoples,12(2),138-150. Heine, H. C. (2002). A Marshall Islands perspective. In F. Pene, A. M. Taufe’ulungaki, & C. Benson (Eds.), Tree of Opportunity: re-thinking Pacific Education (pp. 84 – 90). Suva, Fiji: University of the South Pacific, Institute of Education. Infoplease Staff (2017, February 28). Marshall Islands, retrieved from https://www.infoplease.com/world/countries/marshall-islands Jetnil-Kijiner, K. (2014). Iep Jaltok: A history of Marshallese literature. (Unpublished masters’ thesis). Honolulu, HW: University of Hawaii. Kabua, J. B. (2004). We are the land, the land is us: The moral responsibility of our education and sustainability. In A.L. Loeak, V.C. Kiluwe and L. Crowl (Eds.), Life in the Republic of the Marshall Islands, pp. 180 – 191. Suva, Fiji: University of the South Pacific. Kupferman, D. (2004). Jelalokjen in flux: Pitfalls and prospects of contextualising teacher training programmes in the Marshall Islands. Directions: Journal of Educational Studies, 26(1), 42 – 54. http://directions.usp.ac.fj/collect/direct/index/assoc/D1175062.dir/doc.pdf Miller, R. L. (2010). Wa kuk wa jimor: Outrigger canoes, social change, and modern life in the Marshall Islands (Unpublished masters’ thesis). Honolulu, HW: University of Hawaii. Nabobo-Baba, U. (2008). Decolonising framings in Pacific research: Indigenous Fijian vanua research framework as an organic response. AlterNative: An Indigenous Journal of Indigenous Peoples, 4(2), 141-154. Nimmer, N. E. (2017). Documenting a Marshallese indigenous learning framework (Unpublished doctoral thesis). Honolulu, HW: University of Hawaii. Sanga, K., & Houma, S. (2004). Solomon Islands principalship: Roles perceived, performed, preferred, and expected. Directions: Journal of Educational Studies, 26(1), 55-69. Sanga, K., & Chu, C. (2009). Introduction. In K. Sanga & C. Chu (Eds.), Living and Leaving a Legacy of Hope: Stories by New Generation Pacific Leaders (pp. 10-12). NZ: He Parekereke & Victoria University of Wellington. Suaalii-Sauni, T., & Fulu-Aiolupotea, S. M. (2014). Decolonising Pacific research, building Pacific research communities, and developing Pacific research tools: The case of the talanoa and the faafaletui in Samoa. Asia Pacific Viewpoint, 55(3), 331-344. Taafaki, I., & Fowler, M. K. (2019). Clothing mats of the Marshall Islands: The history, the culture, and the weavers. US: Kindle Direct. Taufe’ulungaki, A. M. (2014). Look back to look forward: A reflective Pacific journey. In M. ‘Otunuku, U. Nabobo-Baba, S. Johansson Fua (Eds.), Of Waves, Winds, and Wonderful Things: A Decade of Rethinking Pacific Education (pp. 1-15). Fiji: USP Press. Thaman, K. H. (1995). Concepts of learning, knowledge and wisdom in Tonga, and their relevance to modern education. Prospects, 25(4), 723-733. Thaman, K. H. (1997). Reclaiming a place: Towards a Pacific concept of education for cultural development. The Journal of the Polynesian Society, 106(2), 119-130. Thiong’o, N. W. (1986). Decolonising the mind: The politics of language in African literature. Kenya: East African Educational Publishers. Vaioleti, T. (2006). Talanoa research methodology: A developing position on Pacific research. Waikato Journal of Education, 12, 21-34. Walsh, J. M., Heine, H. C., Bigler, C. M., & Stege, M. (2012). Etto nan raan kein: A Marshall Islands history (First Edition). China: Bess Press.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

The Qianyingzi Coal Mine is located in the west of the Suxian Mining District of the Huaibei Coalfield, eastern China. The study on structural development patterns and genetic mechanisms in this mine lays an important foundation for safe and efficiently underground mining, and is also the key to understanding the regional tectonic evolution. In this study, based on the analysis of three-dimensional seismic, drilling and underground measured data and regional tectonic correlation, the structures, evolution history and dynamic background of the Qianyingzi Coal Mine are discussed. The Carboniferous-Permian coal measure strata in the mine are generally a gentle syncline with a NNE-trending axis, and cut by a series of faults. The faults developed in this mine are mainly medium- and small-sized with a throw of less than 20 m, and the number of reverse faults is significantly greater than that of normal faults. The strikes of reverse and normal faults are both mainly NE, followed by NNE and nearly N‒S. According to the characteristics of structural geometry, tectonic association, fault property and cross-cutting relation, the structural deformation of coal measure strata in the Qianyingzi Coal Mine can be divided into five stages, and the corresponding tectonic stress fields are NWW‒SEE compressive stress, nearly E‒W compressive stress, NW‒SE compressive stress, nearly E‒W and NW‒SE extensional stresses, respectively. It developed the Fengjia Syncline with a NNE-trending axis in the first stage and nearly N‒S-striking reverse faults in the second stage, which were the results of foreland deformation and subsequent continent-continent collision during the convergence of the North China Craton and South China Plate in the Indosinian period. The NNE-striking reverse sinistral faults and NE-striking reverse faults developed in the third stage is related to the rapid oblique subduction of the Izanagi Plate toward the East Asian continental margin at the beginning of the Early Cretaceous in the western Pacific region. Later, the fourth and fifth stages of the nearly N‒S- and NE-SW-striking normal faults were developed under the backarc extensional background in eastern China during the Early Cretaceous. These new results can be used to guide the rational arrangement for underground mining and also provide a new understanding for regional tectonic evolution of the Huaibei Coalfield.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Reconstructing the growth process of the Qiangtang terrane in space and time is crucial for understanding the geological evolution of Central Tibet. However, its growth process and dynamic mechanism remain unclear. Here, we present new fission track data obtained along a N-S transect near the Puruo Kangri Mountain in the central zone of the Northern Qiangtang terrane. The completely reset apatite fission track ages of detrital samples range from 65.1 to 89.6 Ma, which show a northward younging trend. The thermal history modeling results indicate that this region underwent northward-propagating exhumation during the Late Cretaceous (ca. 92−65 Ma). Our data, combined with previously reported low-temperature thermochronology data for the Qiangtang terrane, suggest that the Qiangtang terrane experienced three main stages of cooling: ca. 120−65, ca. 55−35, and &lt;25−0 Ma. The first stage (ca. 120−65 Ma) displays an outward-propagating cooling pattern from the Central Qiangtang terrane, which was related to the crustal shortening and thickening driven by the Lhasa-Qiangtang collision. The low exhumation rate, flat lavas, and paleoaltimetry studies imply that the central and southern zones of the Northern Qiangtang terrane and Central Qiangtang terrane may form plateau landscape by 65−55 Ma. The second stage (ca. 55−35 Ma) of cooling is mainly documented in the Southern Qiangtang terrane, and the northern zone of the Northern Qiangtang terrane. This cooling event was caused by the crustal deformation and shortening driven by intracontinental subduction related to ongoing convergence of the Indian and Asian plates. Subsequently, both the transition to low erosion rates (&lt;0.05 mm/yr) and paleoaltimetry data indicate that the Qiangtang terrane became a primitive plateau by ca. 35 Ma. The final stage (&lt;25−0 Ma) of cooling was linked to the E-W extension in the Qiangtang terrane.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Background: Heart failure (HF) admissions are frequent and result in significant expenditures. Identifying predictors of increased length of stay (LOS), particularly above the median LOS, may help providers set expectations for patients and target resources effectively. Methods: We analyzed HF admissions (n= 70,094) from January 2005 through April 2007 from 246 hospitals in the AHA's Get With The Guidelines-HF program. In a subset with BNP (n=44,535), baseline characteristics, admission vital signs and selected labs (BNP, creatinine, BUN, hemoglobin, and sodium) were included in a multivariable regression analysis to determine factors associated with LOS ≥4 days. Results: Patients were median age of 72, 45% female, 53% had ischemic etiology, and median LVEF was 35%. Median LOS was 4 days (25 th ,75 th 2,6). The most significant predictors of LOS ≥ 4 days were a higher admission BUN, higher heart rate, and lower SBP (Table 1). Age, insurance, race, creatinine, and LVEF were not. Conclusion: Upon admission for HF, certain vital signs, comorbidites, and laboratory values are associated with an increased likelihood of a LOS ≥ 4 days. These observations may be of value in the implementation of interventions aimed at reducing LOS and improving quality of care in HF. Variables Associated With Hospital LOS >/= 4 Days Variable Chi-Square OR Lower (95% CI) Upper (95% CI) P-value Admissioun BUN (/1 unit increase) 221.8 1.01 1.01 1.01 <.001 Admission SBP (/ 10-unit increase) 129.6 0.96 0.95 0.96 <.001 Heart Rate (/ 10-unit increase) 122.4 1.07 1.06 1.09 <.001 History of COPD/Asthma 45.8 1.19 1.13 1.25 <.001 Admission BNP (per 100-unit increase) 37.6 1.01 1.00 1.01 <.001 Female vs. Male 29.7 1.12 1.08 1.17 <.001 History of renal insufficiency 27.4 1.17 1.10 1.24 <.001 History of heart failure 18.0 0.89 0.85 0.94 <.001 Region: (MW vs. NE) (S vs NE) (W vs. NE) 17.3 0.71 0.91 0.71 0.60 .077 0.56 0.85 1.08 0.88 <.001

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Edelmayer, Friedrich / Gerhard Pfeisinger (Hrsg.), Ozeane. Mythen, Interaktionen und Konflikte (Studien zur Geschichte und Kuktur der iberischen und iberoamerikanischen Länder, 16), Münster 2017, Aschendorff, 336 S. / Abb., € 49,00. (Ruth Schilling, Bremen / Bremerhaven) Jaynes, Jeffrey, Christianity beyond Christendom. The Global Christian Experience on Medieval Mappaemundi and Early Modern World Maps (Wolfenbütteler Forschungen, 149), Wiesbaden 2018, Harrassowitz in Kommission, 483 S. / Abb., € 128,00. (Gerda Brunnlechner, Hagen) Weltecke, Dorothea (Hrsg.), Essen und Fasten. Interreligiöse Abgrenzung, Konkurrenz und Austauschprozesse / Food and Fasting. Interreligious Differentiations, Competition and Exchange (Beihefte zum Archiv für Kulturgeschichte, 81), Köln / Weimar / Wien 2017, Böhlau, 130 S., € 30,00. (Helmut W. Klug, Graz) Dirmeier, Artur (Hrsg.), Essen und Trinken im Spital. Ernährungskultur zwischen Festtag und Fasttag (Studien zur Geschichte des Spital-‍, Wohlfahrts- und Gesundheitswesens, 13), Regensburg 2018, Pustet, 287 S. / Abb., € 34,95. (Josef Matzerath, Dresden) Widder, Ellen / Iris Holzwart-Schäfer / Christian Heinemeyer (Hrsg.), Geboren, um zu herrschen? Gefährdete Dynastien in historisch-interdisziplinärer Perspektive (Bedrohte Ordnungen, 10), Tübingen 2018, Mohr Siebeck, VIII u. 307 S. / Abb., € 59,00. (Lennart Pieper, Münster) Füssel, Marian / Philip Knäble / Nina Elsemann (Hrsg.), Wissen und Wirtschaft. Expertenkulturen und Märkte vom 13. bis 18. Jahrhundert, Göttingen / Bristol 2017, Vandenhoeck &amp; Ruprecht, 418 S. / Abb., € 70,00. (Justus Nipperdey, Saarbrücken) Whittle, Jane (Hrsg.), Servants in Rural Europe. 1400 – 1900, Woodbridge 2017, Boydell &amp; Brewer, XIII u. 271 S., £ 19,99. (Werner Troßbach, Witzenhausen) Rutz, Andreas, Die Beschreibung des Raums. Territoriale Grenzziehungen im Heiligen Römischen Reich (Norm und Struktur, 47), Köln / Weimar / Wien 2018, Böhlau, 583 S. / Abb., € 80,00. (Falk Bretschneider, Paris) Denzel, Markus A. / Andrea Bonoldi / Anne Montenach / Françoise Vannotti (Hrsg.), Oeconomia Alpium I: Wirtschaftsgeschichte des Alpenraums in vorindustrieller Zeit. Forschungsaufriss, -konzepte und -perspektiven, Berlin / Boston 2017, de Gruyter Oldenbourg, VIII u. 313 S., € 99,95. (Franziska Neumann, Rostock) Rothmann, Michael / Helge Wittmann (Hrsg.), Reichsstadt und Geld. 5. Tagung des Mühlhäuser Arbeitskreises für Reichsstadtgeschichte, Mühlhausen 27. Februar bis 1. März 2017 (Studien zur Reichsstadtgeschichte, 5), Petersberg 2018, Imhof, 397 S. / Abb., € 29,95. (Angela Huang, Lübeck) Borgolte, Michael (Hrsg.), Enzyklopädie des Stiftungswesens in mittelalterlichen Gesellschaften, Bd. 1: Grundlagen, Berlin / Boston 2014, de Gruyter, 713 S. / Abb., € 209,00. (Christine Kleinjung, Mainz / Göttingen) Borgolte, Michael (Hrsg.), Enzyklopädie des Stiftungswesens in mittelalterlichen Gesellschaften, Bd. 2: Das soziale System Stiftung, Berlin / Boston 2016, de Gruyter, 760 S. / Abb., € 169,95. (Christine Kleinjung, Mainz / Göttingen) Borgolte, Michael (Hrsg.), Enzyklopädie des Stiftungswesens in mittelalterlichen Gesellschaften, Bd. 3: Stiftung und Gesellschaft, Berlin / Boston 2017, de Gruyter, 680 S. / Abb., € 199,95. (Christine Kleinjung, Mainz / Göttingen) Becher, Matthias (Hrsg.), Die mittelalterliche Thronfolge im europäischen Vergleich (Vorträge und Forschungen, 84), Ostfildern 2017, Thorbecke, 484 S., € 56,00. (Gerhard Lubich, Bochum) Reinle, Christine (Hrsg.), Stand und Perspektiven der Sozial- und Verfassungsgeschichte zum römisch-deutschen Reich. Der Forschungseinfluss Peter Moraws auf die deutsche Mediävistik (Studien und Texte zur Geistes- und Sozialgeschichte des Mittelalters, 10), Affalterbach 2016, Didymos-Verlag, 275 S. / Abb., € 54,00. (Christian Jörg, Tübingen) Flemmig, Stephan / Norbert Kersken (Hrsg.), Akteure mittelalterlicher Außenpolitik: Das Beispiel Ostmitteleuropas (Tagungen zur Ostmitteleuropaforschung, 35), Marburg 2017, Verlag Herder-Institut, VI u. 376 S., € 57,50. (Sabine Wefers, Jena) Neumann, Christian A., Venedig und Aragon im Spätmittelalter (1280 – 1410). Eine Verflechtungsgeschichte (Mittelmeerstudien, 15), Paderborn 2017, Fink / Schöningh, 809 S. / CD-ROM, € 129,00. (Tobias Daniels, München) Blennemann, Gordon / Christine Kleinjung / Thomas Kohl (Hrsg.), Konstanz und Wandel. Religiöse Lebensformen im europäischen Mittelalter (Studien und Texte zur Geistes- und Sozialgeschichte des Mittelalters, 11), Affalterbach 2016, Didymos-Verlag, 280 S. / Abb., € 54,00. (Jörg Sonntag, Dresden) Deutschländer, Gerrit / Ingrid Würth (Hrsg.), Eine Lebenswelt im Wandel. Klöster in Stadt und Land (Quellen und Forschungen zur Geschichte Sachsen-Anhalts, 14), Halle a. d. S. 2017, Mitteldeutscher Verlag, 287 S. / Abb., € 35,00. (Niels Petersen, Göttingen) Holbach, Rudolf / David Weiss (Hrsg.), Vorderfflik twistringhe unde twydracht. Städtische Konflikte im späten Mittelalter (Oldenburger Schriften zur Geschichtswissenschaft, 18), Oldenburg 2017, BIS-Verlag, 244 S. / Abb., € 22,80. (Robin Köhler-Kelzenberg, Bochum) Kah, Daniela, Die wahrhaft königliche Stadt. Das Reich in den Reichsstädten Augsburg, Nürnberg und Lübeck im Späten Mittelalter (Studies in Medieval and Reformation Traditions, 211), Leiden / Boston 2018, Brill, X u. 455 S. / Abb., € 125,00. (Marco Tomaszewski, Freiburg i. Br.) Kobayashi, Asami, Papsturkunden in Lucca (1227 – 1276). Überlieferung – Analyse – Edition (Archiv für Diplomatik, Schriftgeschichte, Siegel- und Wappenkunde, Beiheft 15), Köln / Weimar / Wien 2017, Böhlau, 582 S., € 70,00. (Werner Maleczek, Wien) Fumasoli, Beat, Wirtschaftserfolg zwischen Zufall und Innovativität. Oberdeutsche Städte und ihre Exportwirtschaft im Vergleich (1350 – 1550) (Vierteljahrschrift für Sozial- und Wirtschaftsgeschichte. Beihefte, 241), Stuttgart 2017, Steiner, 580 S., € 82,00. (Oswald Bauer, Kastelruth) Gneiß, Markus, Das Wiener Handwerksordnungsbuch (1364 – 1555). Edition und Kommentar (Quelleneditionen des Instituts für Österreichische Geschichtsforschung, 16), Wien / Köln / Weimar 2017, Böhlau, 670 S. / Abb., € 130,00. (Patrick Schmidt, Rostock) Andresen, Suse, In fürstlichem Auftrag. Die gelehrten Räte der Kurfürsten von Brandenburg aus dem Hause Hohenzollern im 15. Jahrhundert (Schriftenreihe der Historischen Kommission bei der Bayerischen Akademie der Wissenschaften, 97), Göttingen 2017, Vandenhoeck &amp; Ruprecht, 655 S. / Abb., € 90,00. (Markus Frankl, Würzburg) Lüpke, Beatrice von, Nürnberger Fastnachtspiele und städtische Ordnung (Bedrohte Ordnung, 8), Tübingen 2017, Mohr Siebeck, 286 S., € 64,00. (Thorsten Schlauwitz, Erlangen) Wenzel, Silke, Lieder, Lärmen, „L’homme armé“. Musik und Krieg 1460 – 1600 (Musik der frühen Neuzeit, 4), Neumünster 2018, von Bockel, 422 S. / Abb., € 48,00. (Kirstin Wichern, Bad Homburg) Wilangowski, Gesa, Frieden schreiben im Spätmittelalter. Entstehung einer Vertragsdiplomatie zwischen Maximilian I., dem römisch-deutschen Reich und Frankreich (Ancien Régime, Aufklärung und Revolution, 44), Berlin / Boston 2017, de Gruyter Oldenbourg, X u. 288 S., € 69,95. (Harald Kleinschmidt, Tokio) Gamper, Rudolf, Joachim Vadian 1483/84 – 1551. Humanist, Arzt, Reformator, Politiker, Zürich 2017, Chronos, 391 S. / Abb., € 48,00. (Jan-Hendryk de Boer, Essen) Sowerby, Tracey A. / Jan Hennings (Hrsg.), Practices of Diplomacy in the Early Modern World c. 1410 – 1800 (Routledge Research in Early Modern History), London / New York 2017, Routledge, VII u. 306 S. / Abb., £ 105,00. (Hillard von Thiessen, Rostock) Weber, Alison (Hrsg.), Devout Laywomen in the Early Modern World (Women and Gender in the Early Modern World), London / New York 2016, Routledge, XIII u. 373 S. / Abb., £ 110,00. (Andreas Rutz, Bonn / Düsseldorf) Richter, Susan / Michael Roth / Sebastian Meurer (Hrsg.), Konstruktionen Europas in der Frühen Neuzeit. Geographische und historische Imaginationen. Beiträge zur 11. Arbeitstagung „Globale Verflechtungen – Europa neu denken“ der Arbeitsgemeinschaft Frühe Neuzeit im Verband der Historiker und Historikerinnen Deutschlands, 17. bis 19. September 2015 in Heidelberg, Heidelberg 2017, Heidelberg University Publishing, 338 S., € 54,90. (Elisabeth Lobenwein, Klagenfurt) Mallinckrodt, Rebekka von / Angela Schattner (Hrsg.), Sports and Physical Exercise in Early Modern Europe. New Perspectives on the History of Sports and Motion, London / New York 2016, Routledge, XII u. 272 S. / Abb., £ 110,00. (Michael Jucker, Luzern) Mulryne, James R. / Krista De Jonge / Pieter Martens / Richard L. M. Morris (Hrsg.), Architectures of Festival in Early Modern Europe. Fashioning and Re-fashioning Urban and Courtly Space (European Festival Studies: 1450 – 1700), London / New York 2018, Routledge, XXIV u. 335 S. / Abb., £ 105,00. (Jill Bepler, Wolfenbüttel) Adelman, Howard T., Women and Jewish Marriage Negotiations in Early Modern Italy. For Love and Money (Routledge Research in Early Modern History), London / New York 2018, Routledge, XIV u. 206 S., £ 120,00. (Bettina Pfotenhauer, München) Cristellon, Cecilia, Marriage, the Church, and Its Judges in Renaissance Venice, 1420 – 1545 (Early Modern History: Society and Culture), Cham 2017, Palgrave Macmillan, XVII u. 286 S., € 96,29. (Bettina Pfotenhauer, München) Sweet, Rosemary / Gerrit Verhoeven / Sarah Goldsmith (Hrsg.), Beyond the Grand Tour. Northern Metropolises and Early Modern Travel Behaviour, London / New York 2017, Routledge, IX u. 228 S., £ 110,00. (Michael Maurer, Jena) Naum, Magdalena / Fredrik Ekengren (Hrsg.), Facing Otherness in Early Modern Sweden. Travel, Migration and Material Transformations 1500 – 1800 (The Society for Post-Mediaeval Archaeology Monograph, 10), Woodbridge 2018, Boydell Press, XVI u. 367 S. / Abb., £ 40,00. (Heiko Droste, Stockholm) Klaniczay, Gábor / Éva Pócs (Hrsg.), Witchcraft and Demonology in Hungary and Transylvania (Palgrave Historical Studies in Witchcraft and Magic), Cham 2017, Palgrave Macmillan, XIV u. 412 S., € 96,29. (Karen Lambrecht, St. Gallen) Bongartz, Josef / Alexander Denzler / Ellen Franke / Britta Schneider / Stefan A. Stodolkowitz (Hrsg.), Was das Reich zusammenhielt. Deutungsansätze und integrative Elemente (Quellen und Forschungen zur höchsten Gerichtsbarkeit im Alten Reich, 71), Köln / Weimar / Wien 2017, Böhlau, 182 S., € 60,00. (Jonas Stephan, Bad Sassendorf) Stretz, Torben, Juden in Franken zwischen Mittelalter und Früher Neuzeit. Die Grafschaften Castell und Wertheim im regionalen Kontext (Forschungen zur Geschichte der Juden. Abteilung A: Abhandlungen, 26), Wiesbaden 2017, Harrassowitz, X u. 598 S. / Abb., € 89,00. (Maja Andert, Würzburg) Schmölz-Häberlein, Michaela (Hrsg.), Jüdisches Leben in der Region. Herrschaft, Wirtschaft und Gesellschaft im Süden des Alten Reiches (Stadt und Region in der Vormoderne, 7; Judentum – Christentum – Islam, 16), Baden-Baden 2018, Ergon, 377 S. / Abb., € 58,00. (Rotraud Ries, Würzburg) Stalljohann-Schemme, Marina, Stadt und Stadtbild in der Frühen Neuzeit. Frankfurt am Main als kulturelles Zentrum im publizistischen Diskurs (Bibliothek Altes Reich, 21), Berlin / Boston 2017, de Gruyter Oldenbourg, X u. 493 S. / Abb., € 89,95. (Johannes Arndt, Münster) Schmidt-Funke, Julia A. / Matthias Schnettger (Hrsg.), Neue Stadtgeschichte‍(n). Die Reichsstadt Frankfurt im Vergleich (Mainzer Historische Kulturwissenschaften, 31), Bielefeld 2018, transcript, 483 S. / Abb., € 49,99. (Holger Th. Gräf, Marburg) Huber, Vitus, Beute und Conquista. Die politische Ökonomie der Eroberung Neuspaniens (Campus Historische Studien, 76), Frankfurt a. M. 2018, Campus, 432 S. / Abb., € 39,95. (Laura Dierksmeier und Anna Weininger, Tübingen) Caravale, Giorgio, Preaching and Inquisition in Renaissance Italy. Words on Trial, übers. v. Frank Gordon (Catholic Christendom, 1300 – 1700), Leiden / Boston 2016, Brill, VIII u. 274 S., € 115,00. (Andreea Badea, Frankfurt a. M.) Mertens, Dieter, Humanismus und Landesgeschichte. Ausgewählte Aufsätze, 2 Teile, hrsg. v. Dieter Speck / Birgit Studt / Thomas Zotz (Veröffentlichungen der Kommission für geschichtliche Landeskunde in Baden-Württemberg. Reihe B: Forschungen, 218), Stuttgart 2018, Kohlhammer, XIV u. 1042 S. / Abb., € 88,00. (Ulrich Muhlack, Frankfurt a. M.) Grimmsmann, Damaris, Krieg mit dem Wort. Türkenpredigten des 16. Jahrhunderts im Alten Reich (Arbeiten zur Kirchengeschichte, 131), Berlin / Boston 2016, de Gruyter, XII u. 317 S., € 109,95 (Alexander Schunka, Berlin) Bauer, Joachim / Stefan Michel (Hrsg.), Der „Unterricht der Visitatoren“ und die Durchsetzung der Reformation in Kursachsen (Leucorea-Studien zur Geschichte der Reformation und der Lutherischen Orthodoxie, 29), Leipzig 2017, Evangelische Verlagsanstalt, 278 S., € 58,00. (Thomas Fuchs, Leipzig) Stegmann, Andreas, Die Reformation in der Mark Brandenburg, Leipzig 2017, Evangelische Verlagsanstalt, 279 S. / Abb., € 34,00. (Thomas Fuchs, Leipzig) Mariotte, Jean-Yves, Philipp der Großmütige von Hessen (1504 – 1567). Fürstlicher Reformator und Landgraf, übers. v. Sabine Albrecht (Veröffentlichungen der Historischen Kommission für Hessen, 24; Quellen und Darstellungen zur Geschichte des Landgrafen Philipp des Großmütigen, 10), Marburg 2018, Historische Kommission für Hessen, 301 S. / Abb., € 28,00. (Thomas Fuchs, Leipzig) Doll, Eberhard, Der Theologe und Schriftsteller Friedrich Dedekind (1524/25 – 1598). Eine Biographie. Mit einem Beitrag von Britta-Juliane Kruse zu Dedekinds geistlichen Spielen und der Erstedition der „Hochtzeit zu Cana in Galilea“ (Wolfenbütteler Forschungen, 145), Wiesbaden 2018, Harrassowitz in Kommission, 623 S. / Abb., € 92,00. (Julia Zech, Sarstedt) Bullinger, Heinrich, Tigurinerchronik, 3 Teilbde., hrsg. v. Hans U. Bächtold (Werke. Vierte Abteilung: Historische Schriften, 1), Zürich 2018, Theologischer Verlag Zürich, XXVII u. 1388 S. (Teilbde. 1 u. 2); V u. 425 S. / Abb. (Teilbd. 3), € 450,00. (Volker Leppin, Tübingen) Francisco de Vitoria, De iustitia / Über die Gerechtigkeit, Teil 1 u. 2, hrsg., eingel. u. ins Deutsche übers. v. Joachim Stüben, mit Einleitungen v. Thomas Duve (Teil 1) bzw. Tilman Repgen (Teil 2) (Politische Philosophie und Rechtstheorie des Mittelalters und der Neuzeit, Reihe I: Texte, 3 bzw. 4), Stuttgart-Bad Cannstatt 2013 bzw. 2017, Frommann-Holzboog, CXII u. 191 S. bzw. CIX u. 355 S., € 168,00 bzw. € 188,00. (Nils Jansen, Münster) Der Portulan-Atlas des Battista Agnese. Das Kasseler Prachtexemplar von 1542, hrsg., eingel. u. komm. v. Ingrid Baumgärtner, Darmstadt 2017, Wissenschaftliche Buchgesellschaft, 144 S. / Abb., € 99,95. (Christoph Mauntel, Tübingen) Brevaglieri, Sabina / Matthias Schnettger (Hrsg.), Transferprozesse zwischen dem Alten Reich und Italien im 17. Jahrhundert. Wissenskonfigurationen – Akteure – Netzwerke (Mainzer Historische Kulturwissenschaften, 29), Bielefeld 2018, transcript, 341 S. / Abb., € 39,99. (Christiane Liermann, Como) Asmussen, Tina, Scientia Kircheriana. Die Fabrikation von Wissen bei Athanasius Kircher (Kulturgeschichten, 2), Affalterbach 2016, Didymos-Verlag, 220 S. / Abb., € 39,00. (Mona Garloff, Stuttgart / Wien) Schlegelmilch, Sabine, Ärztliche Praxis und sozialer Raum im 17. Jahrhundert. Johannes Magirus (1615 – 1697), Wien / Köln / Weimar 2018, Böhlau, 352 S. / Abb., € 50,00. (Pierre Pfütsch, Stuttgart) Félicité, Indravati, Das Königreich Frankreich und die norddeutschen Hansestädte und Herzogtümer (1650 – 1730). Diplomatie zwischen ungleichen Partnern, übers. aus dem Französischen v. Markus Hiltl (Quellen und Darstellungen zur hansischen Geschichte. Neue Folge, 75), Köln / Weimar / Wien 2017, Böhlau, 439 S., € 60,00. (Guido Braun, Mulhouse) Renault, Rachel, La permanence de l’extraordinaire. Fiscalité, pouvoirs et monde social en Allemagne aux XVIIe et XVIIIe siècles (Histoire moderne, 57), Paris 2017, Éditions de la Sorbonne, 389 S. / Abb., € 25,00. (Claire Gantet, Fribourg) Godsey, William D., The Sinews of Habsburg Power. Lower Austria in a Fiscal-Military State 1650 – 1820, Oxford 2018, Oxford University Press, XX u. 460 S. / Abb., £ 90,00. (Simon Karstens, Trier) Riotte, Andrea, Diese so oft beseufzte Parität. Biberach 1649 – 1825: Politik – Konfession – Alltag (Veröffentlichungen der Kommission für geschichtliche Landeskunde in Baden-Württemberg. Reihe B: Forschungen, 213), Stuttgart 2017, Kohlhammer, LII u. 779 S., € 64,00. (Stephanie Armer, Nürnberg) Müller, Andreas, Die Ritterschaft im Herzogtum Westfalen 1651 – 1803. Aufschwörung, innere Struktur und Prosopographie (Veröffentlichungen der Historischen Kommission für Westfalen. Neue Folge, 34), Münster 2017, Aschendorff, 744 S. / Abb., € 69,00. (Nicolas Rügge, Hannover) Lange, Johan, Die Gefahren der akademischen Freiheit. Ratgeberliteratur für Studenten im Zeitalter der Aufklärung (1670 – 1820) (Beihefte der Francia, 84), Ostfildern 2017, Thorbecke, 339 S., € 45,00. (Andreas Erb, Dessau) Schwerhoff, Gerd, Köln im Ancien Régime. 1686 – 1794 (Geschichte der Stadt Köln, 7), Köln 2017, Greven, XIV u. 552 S. / Abb., € 60,00. (Patrick Schmidt, Rostock) James, Leonie, „This Great Firebrand“. William Laud and Scotland, 1617 – 1645 (Studies in Modern British Religious History, 36), Woodbridge / Rochester 2017, The Boydell Press, XIV u. 195 S., £ 60,00. (Martin Foerster, Hamburg) Campbell, Alexander D., The Life and Works of Robert Baillie (1602 – 1662). Politics, Religion and Record-Keeping in the British Civil Wars (St. Andrews Studies in Scottish History, 6), Woodbridge / Rochester 2017, The Boydell Press, IX u. 259 S., £ 75,00. (Ronald G. Asch, Freiburg i. Br.) Parrish, David, Jacobitism and Anti-Jacobitism in the British Atlantic World, 1688 – 1727 (Studies in History. New Series), Woodbridge / Rochester 2017, The Boydell Press, X u. 189 S., £ 50,00. (Ronald G. Asch, Freiburg i. Br.) Graham, Aaron / Patrick Walsh (Hrsg.), The British Fiscal-Military State, 1660 – c. 1783, London / New York 2016, Routledge, XI u. 290 S. / Abb., £ 80,00. (Torsten Riotte, Frankfurt a. M.) Hoppit, Julian, Britain’s Political Economies. Parliament and Economic Life, 1660 – 1800, Cambridge 2017, Cambridge University Press, XXII u. 391 S. / graph. Darst., £ 22,99. (Justus Nipperdey, Saarbrücken) Talbot, Michael, British-Ottoman Relations, 1661 – 1807. Commerce and Diplomatic Practice in Eighteenth-Century Istanbul, Woodbridge / Rochester 2017, The Boydell Press, XIII u. 256 S. / graph. Darst., £ 70,00. (Christine Vogel, Vechta) Niggemann, Ulrich, Revolutionserinnerung in der Frühen Neuzeit. Refigurationen der „Glorious Revolution“ in Großbritannien (1688 – 1760) (Veröffentlichungen des Deutsche Historischen Instituts London, 79), Berlin / Boston 2017, de Gruyter, XII u. 653 S. / Abb., € 64,95. (Georg Eckert, Wuppertal) duch*eyne, Steffen (Hrsg.), Reassessing the Radical Enlightenment, London / New York 2017, Routledge, XII u. 318 S., £ 32,99. (Bettina Dietz, Hongkong) Lehner, Ulrich (Hrsg.), Women, Enlightenment and Catholicism. A Transnational Biographical History, London / New York 2018, Routledge, XI u. 236 S. / Abb., £ 100,00. (Elisabeth Fischer, Hamburg) Möller, Horst / Claus Scharf / Wassili Dudarew / Maja Lawrinowitsch (Hrsg.), Deutschland – Russland. Stationen gemeinsamer Geschichte, Orte der Erinnerung, Bd. 1: Das 18. Jahrhundert, Berlin / Boston 2018, de Gruyter Oldenbourg, 410 S. / Abb., € 29,95. (Martina Winkler, Kiel) Bittner, Anja, Eine königliche Mission. Der französisch-jakobitische Invasionsversuch von 1708 im europäischen Kontext (Schriften des Frühneuzeitzentrums Potsdam, 6), Göttingen 2017, V&amp;R unipress, 277 S., € 45,00. (Torsten Riotte, Frankfurt a.M.) Schmidt-Voges, Inken / Ana Crespo Solana (Hrsg.), New Worlds? Transformations in the Culture of International Relations around the Peace of Utrecht, London / New York 2017, Routledge, IX u. 232 S., £ 105,00. (Anuschka Tischer, Würzburg) Mager, Ria, Zwischen Legitimation und Inspektion. Die Rheinlandreise Napoleon Bonapartes im Jahre 1804 (Konsulat und Kaiserreich, 4), Frankfurt a. M. [u. a.] 2016, Lang, 330 S., € 61,95. (Josef Johannes Schmid, Mainz)

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Brugmansia suaveolens (Humb. and Bonpl. ex Willd.) Bercht. and J. Presl, also called White Angel’s Trumpet is an ornamental plant known, for its medicinal properties and as an invasive weed (Kwak et al., 2021; Petricevich et al., 2020). It belongs to the Solanaceae family, with a center of origin in South America, and it is currently found all over the world (Petricevich et al., 2020). In February 2020, B. suaveolens plants cultivated in a single garden in Vianópolis region (16°56'60.0"S 48°29'16.0"W), Goiás state, Brazil were observed presenting yellowing symptoms, with descending branches death. When the roots were inspected, a large number of galls were found, typical of root-knot nematodes. Samples of soil and root were sent to a Nematology Laboratory (LabNema) at São Paulo State University, Jaboticabal Campus. Forty-one thousand six hundred eggs and second-stage juveniles (J2s) were extracted from 100 cm³ of soil and 7,600 eggs and J2s of Meloidogyne sp. per gram of root. Morphological, enzymatic, and molecular techniques were used to identify the species. The perineal pattern of the females (n = 15) had a high dorsal arch, with thick streaks and a trapezoidal shape. The male labial region (n = 15) had a trapezoidal shape with apparent annulations (Eisenback and Hirschmann, 1981; Nascimento et al., 2021; Taylor and Netscher, 1974). The morphological characteristics of adults were similar to those originally described for M. incognita (Kofoid and White, 1919) Chitwood 1949. The profile of the isoenzyme esterase was studied (n = 16) and the phenotype I1, characteristic of M. incognita, was found (Esbenshade and Triantaphyllou, 1985). Genomic DNA (N = 20) was obtained through DNA of females, extracted by Worm Lysis Buffer (WLB) (Carvalho et al., 2019). Two sets of primers were used, Finc-1: GGGATGTGTAAATGCTCCTG, Rinc-1: CCCGCTACACCCTCAACTTC (Randig et al., 2002) and Finc-4: GTGAGGATTCAGCTCCCCAG, Rinc-4: ACGAGGAACATACTTCTCCGTCC (Meng et al., 2004), specific for M. incognita, which amplified fragments of 399 and 955 bp, respectively, confirming the species. A pathogenicity test was conducted under greenhouse conditions. Six newly formed seedlings were transplanted individually into 10-liter pots containing autoclaved soil and, subsequently, each plant was inoculated with 3,000 eggs and J2s from the original population of M. incognita. After 120 days, White Angel’s Trumpet plants showed reduced development, yellow leaves, and many root galls with abundant egg masses on the roots, unlike the non-inoculated plants. Nematodes were extracted from roots. The average recovered reached 78,458 eggs and J2s per plant, corresponding to a reproductive factor (RF) of 26.15. A high RF provides an alert for B. suaveolens cultivation in areas with a history of root-knot nematode infestation. Moreover, this disease outbreak might serve as a source of inoculum for large-scale cultivated plants near the farm, which are generally good hosts for M. incognita. This is the first report presenting Angel’s Trumpet as host of root-knot nematode, M. incognita, in Brazil and the world.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

The miniature paleocontinent in the region of the São Francisco River valley, in eastern Brazil, holds the record of two different glacial epochs. The late Cryogenian Jequitaí Formation from the Bambuí Group is up to 100 m thick and covers areas mainly in the central São Francisco craton. Evidences for glacial sedimentation are beautifully preserved E-W grooves and striations, dropstones within fine-grained rocks, and a full set of diamictites enclosing a rich and complex depositional history. The Jequitaí Formation is in close link with the tectonic evolution of the São Francisco paleocontinent and the West Gondwana amalgamation. From west, the precocious Paranapanema and São Francisco blocks collision in late Cryogenian flexured the foreland lithosphere and created depozones that were infilled by glacial sediments. Toward east, the rifting and opening of the Adamastor Ocean allowed thick glacial and non-glacial deposits to form through subaqueous gravitational sedimentation. From west to east, proximal and distal glaciomarine, glaciocontinental, and non-glacial resedimentation are identified and linked to the evolving continental masses and climate during the Cryogenian and beginning of Ediacaran. The late Paleozoic Santa Fé Group is the youngest record of glaciation on the São Francisco craton. It is 60–80 m thick and yields consistent and confident glacial evidences such as N-S striations on top of Cambrian sandstones, ice-rafted debris, and rain-out diamictite, all preserved in small and patchy areas in the west-central São Francisco craton. Paleocurrents suggest a northern ice center and sedimentary facies indicate deposition in continental lakes and rivers. Although late Paleozoic, its age is poorly constrained and likely correlated with the uppermost Itararé Group (Taciba Formation) of Paraná Basin in south Brazil. Deglaciation and strong isostatic adjustments make up the termination of the Santa Fé Group sedimentary record and depict a glaciocontinental system evolved on an interior stable continental crust. The late Neoproterozoic Jequitaí Formation and the late Paleozoic Santa Fé Group are parts of the earth’s sedimentary history preserving a rich record of climate, tectonic, and surface processes in part controlled by the evolving continental masses on the São Francisco craton.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Metasequoia glyptostroboides Hu & W. C. Cheng (Taxodiaceae), commonly called the Chinese redwood or dawn redwood, is a well-known "living fossil" and rare relict plant species endemic to China, which has been successfully cultivated throughout the world (Ma 2007). In July to September 2020, trees of Chinese redwood which were more than thirty years-old, showed symptoms of decline and death associated with branch dieback, root and collar rot (Fig. 1) in Yangtze River shelter-forests of Jiangling County in Hubei Province, China (112°15′19″E, 30°11′56″N; 40m). Diseased roots and rhizosphere soils were collected in September 2020 and April 2021. Using the baiting method, a hom*othallic Phytophthora sp. was recovered consistently from diseased roots and soil samples of Chinese redwood. All the isolates of this Phytophthora sp. formed similar colonies on V8 agar and corn meal agar (Fig. 2), and then three representative isolates (L4-5-4, L4-5-5 and L4-5-6) were randomly selected for morphological and molecular identification. In distilled water, semipapillate persistent sporangia were borne in simple sympodial branched sporangiophores. Sporangia were predominantly ovoid (Fig. 3a, d and f), but other shapes were observed including subglobose (Fig. 3b), limoniform (Fig. 3c) or distorted shapes (Fig. 3e), averaging 44.1 ± 7.7 µm (n=102) in length and 32.8 ± 5.2 µm (n=102) in width, with narrow exit pores of 8.0 ± 1.4 µm (n=93) and a length/breadth ratio of 1.3 ± 0.10 (n=102). Chlamydospores were not observed. Oogonia were globose or subglobose, 20.51 to 40.15 µm (av. 33.1 ± 3.9 µm) (n=119) in diameter, with smooth walls and paragynous antheridium (Fig. 3g-i). Oospores were globose or subglobose in elongated oogonia with medium wall thickness of 1.9 ± 0.5 µm (n=36), aplerotic or plerotic and 16.9 to 32.6 µm in diameter (av. 26.6 ± 3.8 µm) (n=40). According to the above morphological characteristics, this Phytophthora sp. was placed in Waterhouse's (1963) group III. The sequences of the internal transcribed spacers (ITS) region of nuclear ribosomal DNA of each isolate (GenBank Accession No. OK087320, OK087321 and OK087322) was 760 bp and had identity of 99.84% with three P. acerina isolates (JX951285, JX951291 and JX951296), while the 800 bp β-tubulin (BTUB) sequences (OK140540, OK140541 and OK140542) showed 99.97% hom*ology to the sequence of P. acerina (KC201283) (Ginetti, Moricca and Squires 2014) (Table 1). The ML phylogenetic trees were established by comparing ITS and BTUB sequences of three Phytophthora strains (L4-5-4, L4-5-5 and L4-5-6) with reference sequences of isolates of Phytophthora in ITS and BTUB in GenBank (Fig. 4-5). Based on the morphological and molecular characteristics, the strains were identified as namely P. acerina. In addition, pathogenicity assays were performed with one of the three strains (L4-5-4) on M. glyptostroboides using both one year old and three years old seedlings. Inoculum was prepared by subculturing agar plugs from edges of CMA cultures into V8 medium plates, incubating at 20 ℃ in darkness for 10 days. Six seedlings planted in pots filled with sterilized soil were inoculated by mycelium plug at root collar and stem wounded by a 8 mm diameter puncher. Six control seedlings were inoculated in the same manner as above, and sterile agar plugs were used. After 35 days, inoculated seedlings all had necrotic lesions at the inoculation sites, and some seedlings had the symptoms of foliage blight and dieback, whereas control seedlings remained healthy (Fig. 6). The number of fibrous roots after inoculation was significantly less than the control, and the roots of inoculated seedlings blackened or even rotted, while there were no obvious symptoms in the control (Fig. 7). Phytophthora isolates recovered from the symptomatic tissues of artificially inoculated plants were identical to isolate L4-5-4 in morphological characters and ITS sequencing. This is the first report of P. acerina causing root rot on the Chinese redwood in China. As only the seedlings were inoculated, further research is needed to address the epidemiology and pathogenicity of P. acerina to adult trees of Chinese red wood. References: Ginetti, B. et al. 2014. Plant Pathology, 63(4): 858-876. Ma, J. S. 2007. Bulletin of the Peabody Museum of Natural History, 48(2): 235-253. Waterhouse, G. M. 1963. Mycological Papers 92:1-22

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

NOTE: This article was published in a former series of GEUS Bulletin. Please use the original series name when citing this article, for example: Stemmerik, L., Dalhoff, F., Larsen, B. D., Lyck, J., Mathiesen, A., & Nilsson, I. (1998). Wandel Sea Basin, eastern North Greenland. Geology of Greenland Survey Bulletin, 180, 55-62. https://doi.org/10.34194/ggub.v180.5086 _______________ The Wandel Sea Basin in eastern North Greenland is the northernmost of a series of fault-bounded Late Palaeozoic – Early Tertiary basins exposed along the eastern and northern margin of Greenland (Fig. 1). The basin and the surrounding shelf areas are located in a geologically complex region at the junction between the N–S trending Caledonian fold belt in East Greenland and the E–W trending Ellesmerian fold belt in North Greenland, and along the zone of later, Tertiary, continental break-up. The Wandel Sea Basin started to develop during the Carboniferous as a result of extension and rifting between Greenland and Norway, and Greenland and Spitsbergen (Håkansson & Stemmerik 1989), and was an area of accumulation during the Early Carboniferous – Early Tertiary period. Two main epochs of basin evolution have been recognised during previous studies of the basin fill: an early (late Palaeozoic – early Triassic) epoch characterised by a fairly simple system of grabens and half-grabens, and a late (Mesozoic) epoch dominated by strike-slip movements (Håkansson & Stemmerik 1989). The Mesozoic epoch only influenced the northern part of the basin, north of the Trolle Land fault zone (Fig. 1). Thus the northern and southern parts of the basin have very different structural and depositional histories, and accordingly different thermal histories and hydrocarbon potential. This paper summarises the results of a project supported by Energy Research Program (EFP-94), the purpose of which was to model the Wandel Sea Basin with special emphasis on hydrocarbon potential and late uplift history, and to provide biostratigraphic and sedimentological data that could improve correlation with Svalbard and the Barents Sea. It is mainly based on material collected during field work in Holm Land and Amdrup Land in the south-eastern part of the Wandel Sea Basin during 1993–1995 with additional data from eastern Peary Land (Stemmerik et al. 1996). Petroleum related field studies have concentrated on detailed sedimentological and biostratigraphic studies of the Carboniferous–Permian Sortebakker, Kap Jungersen, Foldedal and Kim Fjelde Formations in Holm Land and Amdrup Land (Fig. 2; Døssing 1995; Stemmerik 1996; Stemmerik et al. 1997). They were supplemented by a structural study of northern Amdrup Land in order to improve the understanding of the eastward extension of the Trolle Land fault system and possibly predict its influence in the shelf areas (Stemmerik et al. 1995a; Larsen 1996). Furthermore, samples for thermal maturity analysis and biostratigraphy were collected from the Mesozoic of Kap Rigsdagen and the Tertiary of Prinsesse Thyra Ø (Fig. 1).

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

I examined variation in community structure, species richness, biomass and abundance of Coprini dung beetles from 45 trapping sites in meadows, 35-year-old secondary forests and primary forests in tropical, high-elevation karst ecosystems of Puluong Nature Reserve, Thanh Hoa Province. My main aim was to explore community response to the influence of land use change. By comparing the structure and community attributes of the beetles between 35-year-old secondary forests and primary forests, I expected to give indications on the conservation value of the old secondary forests for beetle conservation. Community structure significantly differed among land-use types. Species richness, abundance and biomass were significantly higher in forest habitats than in meadows. The cover of ground vegetation, soil clay content and tree diameter are important factors structuring Coprini communities in karst ecosystems of Pu Luong. The secondary forests, after 35 years of regrowth showed similarities in species richness, abundance and biomass to primary forests. This gives hope for the recovery of Coprini communities during forest succession. Keywords: Coprini, dung beetles, karst ecosystems, land use change, Pu Luong. References: [1] I. Hanski, Y. Cambefort, Dung beetle ecology, Princeton University Press, Princeton, 1991.[2] C.H. Scholtz, A.L.V. Davis, U. Kryger, Evolutionary biology and conservation of dung beetles, Pensoft Publisher, Bulgaria, 2009.[3] E. Nichols, S. Spector, J. Louzada, T. Larsen, S. Amezquita, M.E. Favila et al., Ecological functions and ecosystem services provided by Scarabaeinae dung beetles, Biol. Conserv. 141 (2008) 1461-1474. https://doi.org/10.1016/j.biocon.2008.04.011.[4] H.K. Gibbsa, A.S. Rueschb, F. Achardc, M.K. Claytond, P. Holmgrene, N. Ramankuttyf, J.A. Foleyg, Tropical forests were the primary sources of new agricultural land in the 1980s and 1990s, Proc Natl Acad Sci USA 107 (2010) 16732-16737. https://doi.org/10.1073/pnas.0910275107.[5] L.D. Audino, J. Louzada, L. Comita, Dung beetles as indicators of tropical forest restoration success: is it possible to recover species and functional diversity? Biol. Conserv. 169 (2014) 248-257. https://doi.org/10.1016/j.biocon.2013.11.023.[6] W. Beiroz, E.M. Slade, J. Barlow, J.M. Silveira, J. Louzada, E. Sayer, Dung beetle community dynamics in undisturbed tropical forests: implications for ecological evaluations of land-use change, Insect Conservation and Diversity 10 (2017) 94-106. https://doi.org/10.1111/icad.12206.[7] S. Boonrotpong, S. Sotthibandhu, C. Pholpunthin, Species composition of dung beetles in the primary and secondary forests at Ton Nga Chang Wildlife Sanctuary, ScienceAsia 30 (2004) 59-65. https: // doi.org/10.2306/scienceasia1513-1874.2004.30.059.[8] S. Boonrotpong, S. Sotthibandhu, C. Satasook, Species turnover and diel flight activity of species of dung beetles, Onthophagus, in the tropical lowland forest of peninsular Thailand, Journal of Insect Science 12 (77) (2012). https://doi.org/10. 1673/031.012.7701.[9] A.J. Davis, J.D. Holloway, H. Huijbregts, J. Krikken, A.H. Kirk-Spriggs, S.L. Sutton, Dung beetles as indicators of change in the forests of northern Borneo, Journal of Applied Ecology 38 (2001) 593-616. https://doi.org/10.1046/j.1365-2664.2001.00619.x.[10] K. Frank, M. Hülsmann, T. Assmann, T. Schmitt, N. Blüthgen, Land use affects dung beetle communities and their ecosystem service in forests and grasslands, Agriculture, Ecosystems & Environment 243 (2017) 114-122.[11] T.A. Gardner, M.I.M. Hernández, J. Barlow, C.A. Peres, Understanding the biodiversity consequences of habitat change: the value of secondary and plantation forests for neotropical dung beetles, Journal of Applied Ecology 45 (2008) 883-893. https://doi.org/10.1111/j.1365-2664. 2008.01454.x.[12] L. Hayes, D.J. Mann, A.L. Monastyrskii, O.T. Lewis, Rapid assessments of tropical dung beetle and butterfly assemblages: contrasting trends along a forest disturbance gradient, Insect Conservation and Diversity 2 (2009) 194-203. https://doi.org/ 10.1111/j.1752-4598.2009.00058.x.[13] I. Quintero, T. Roslin, Rapid recovery of dung beetle communities following habitat fragmentation in central Amazonia, Ecology 12 (2005) 3303-3311. https://doi.org/10.1890/04-1960.[14] Shahabuddin, C.H. Schulze, T. Tscharntke, Changes of dung beetle communities from rainforests towards agroforestry systems and annual cultures in Sulawesi (Indonesia), Biodiversity and Conservation 14 (2005) 863-877. https://doi.org/10.1007/s10531-004-0654-7.[15] K. Vulinec, Dung beetle communities and seed dispersal in primary forest and disturbed land in Amazonia, Biotropica 34 (2002) 297-309. https:// doi.org/10.1111/j.1744-7429.2002.tb00541.x.[16] K. Vulinec, J.E. Lambert, D.J. Mellow, Primate and dung beetle communities in secondary growth rain forests: implications for conservation of seed dispersal systems, International Journal of Primatology 27 (2006) 855-879. https://doi.org/10. 1007/s10764-006-9027-2.[17] E. Nichols, T. Larsen, S. Spector, A.L. Davis, F. Escobar, M. Favila, K. Vulinec, Global dung beetle response to tropical forest modification and fragmentation: a quantitative literature review and meta-analysis, Biological Conservation 137 (2007) 1-19. https://doi.org/10.1016/j.biocon.2007.01.023.[18] R. Clements, N.S. Sodhi, M. Schilthuizen, K.L.Ng. Peter, Limestone karsts of Southeast Asia: imperiled arks of biodiversity, BioScience 56 (2006) 733-742. https://doi.org/10.1641/0006-3568(2006)56[733:LKOSAI]2.0.CO;2.[19] M. Schilthuizen, T.S. Liew, B.B. Elahan, I. Lackman-Ancrenaz, Effects of karst forest degradation on pulmonate and prosobranch land snail communities in Sabah, Malaysian Borneo, Conservation Biology 19 (2005) 949-954. https://doi.org/10.1111/j.1523-1739.2005.00209.x.[20] C. Costa, V.H.F. Oliveira, R. Maciel, W. Beiroz, V. Korasaki, J. Louzada, Variegated tropical landscapes conserve diverse dung beetle communities, PeerJ 5 (2017). https://doi.org/10. 7717/peerj.3125.[21] R.P. Salomão, D. González-Tokmana, W. Dáttilo, J.C. López-Acosta, M.E. Favila, Landscape structure and composition define the body condition of dung beetles (Coleoptera: Scarabaeinae) in a fragmented tropical rainforest, Ecol. Indic. 88 (2018) 144-151. https://doi.org/ 10.1016/j.ecolind.2018.01.033.[22] R.C. Campos, M.I.M. Hernández, Dung beetle assemblages (Coleoptera, Scarabaeinae) in Atlantic forest fragments in southern Brazil, Revista Brasileira de Entomologia 57 (2013) 47-54.[23] E. Nichols, Fear begets function in the ‘brown’ world of detrital food webs, Journal of Animal Ecology 82(4) (2013) 717-720. https://doi.org/ 10.1111/1365-2656.12099.[24] Tixier, J.M.G. Bloor, J.-P. Lumaret, Species-specific effects of dung beetle abundance on dung removal and leaf litter decomposition, Acta Oecologica 69 (2015) 31-34. https://doi.org/10. 1016/j.actao.2015.08.003.[25] P.M. Farias, L. Arellano, M.I.M. Hernández, S.L. Ortiz, Response of the copro- necrophagous beetle (Coleoptera: Scarabaeinae) assemblage to a range of soil characteristics and livestock management in a tropical landscape, Journal of Insect Conservation 19 (2015) 947-960. https://doi.org/10.1007/s 108 41-015-9812-3.[26] D.C. Osberg, B.M. Doube, S.A. Hanrahan, Habitat specificity in African dung beetles: the effect of soil type on the survival ofdung beetle immatures (Coleoptera: Scarabaeidae), Tropical Zoology 7 (1994) 1-10. https://doi.org/10.1080/03946975. 1994.10539236.[27] E. Andresen, S. Laurance, Possible indirect effects of mammal hunting on dung beetle assemblages in Panama, Biotropica 39 (2006) 141-146. https://doi.org/10.1111/j.1744-7429.2006.00239.x.[28] H. Enari, S. Koike, H. Sakamaki, Influences of different large mammalian fauna on dung beetle diversity in beech forests, Journal of Insect Science 13(54)(2013).https://doi.org/10.1673/031.013. 5401.[29] A. Estrada, D.A. Anzuras, R. Coastes-Estrada, Tropical forest fragmentation, howler monkeys (Alouatta palliata) and dung beetles at Los Tuxtlas, Mexico, American Journal of Primatology 48 (1999) 353-362.[30] C.A. Harvey, J. Gonzalez, E. Somarriba, Dung beetle and terrestrial mammal diversity in forests, indigenous agroforestry systems and plantain monocultures in Talamanca, Costa Rica, Biodiversity and Conservation 15 (2006) 555-585. https://doi.org/10.1007/s10531-005-2088-2.[31] K.V. Nguyễn, T.H. Nguyễn, K.L. Phan, T.H. Nguyễn, Bản đồ sinh khí hậu Việt Nam, Nhà xuất bản Đại học Quốc gia, Hà Nội, 2000.[32] E.J. Sterling, M.M. Hurley, M.D. Le, Vietnam–a natural history, Yale University Press, New Haven, CT, 2006.[33] T. Do, Characteristics of karst ecosystems of Vietnam and their vulnerability to human impact, Acta Geologica Sinica 75 (2001) 325-329.[34] V.T. Thái, Thảm thực vật rừng Việt Nam, Nhà xuất bản Khoa học và kỹ thuật, Hà Nội, 1978. [35] P.G.d. Silva, M.I.M. Hernández, Spatial patterns of movement of dung beetle species in a tropical forest suggest a new trap spacing for dung beetle biodiversity studies. PloS ONE 10 (5) (e0126112) (2015). https://doi.org/10.1371/journal.pone.0126112.[36] V.B. Bui, K. Dumack, M. Bonkowski, Two new species and one new record for the genus Copris (Coleoptera: Scarabaeidae: Scarabaeinae) from Vietnam with a key to Vietnamese species, European Journal of Entomology 115 (2018) 167-191. https://doi.org/10.14411/eje.2018.016.[37] V.B. Bui, M. Bonkowski, Synapsis puluongensis sp. nov. and new data on the poorly known species Synapsis horaki (Coleoptera: Scarabaeidae) from Vietnam with a key to Vietnamese species. Acta Entomologica Musei Nationalis Pragae 58 (2018) 407-418. https://doi.org/10.2478/aemnp-2018-0032.[38] O.N. Kabakov, A. Napolov, Fauna and ecology of Lamellicornia of subfamily Scarabaeinae of Vietnam and some parts of adjacent countries: South China, Laos, and Thailand, Latvijas Entomologs 37 (1999) 58-96.[39] J.E. Brower, J.H. Zar, C.N. Von-Ende, Field and laboratory methods for general ecology, 4th ed. Boston, WCB. McGraw-Hill, 1998.[40] R Core Team, R: A Language and Environment for Statistical Computing. https://www.R-project.org/ (accessed 15 May 2017).[41] J. Oksanen, F.G. Blanchet, M. Friendly, R. Kindt, P. Legendre, D. McGlinn et al., Vegan: Community Ecology Package, R package version 2.4–5 (2017). https://cran.r-project.org/web/packages/vegan.[42] R. Clements, P.K.L. Nga, X.X. Lub, S. Ambu, M. Schilthuizen, C.J.A. Bradshaw, Using biogeographical patterns of endemic land snails to improve conservation planning for limestone karsts, Biological Conservation 141 (2751e2764) (2008). https://doi.org/10.1016/j.biocon.2008.08.011.[43] P.K.L. Ng, D. Guinot, T.M. Iliffe, Revision of the anchialine varunine crabs of the genus Orcovita Ng & Tomascik, 1994 (Crustacea: Decapoda: Brachyura: Grapsidae), with descriptions of four new species, Raffles Bulletin of Zoology 44 (1996) 109-134.[44] P.K.L. Ng, Cancrocaeca xenomorpha, new genus and species, a blind troglobitic freshwater hymenosomatid (Crustacea: Decapoda: Brachyura) from Sulawesi, Indonesia, Raffles Bulletin of Zoology 39 (1991) 59-73.[45] V. Balthasar, Monographie der Scarabaeidae und Aphodiidae der Palaearktischen und Orientalischen Region. Coleoptera: Lamellicornia. Band 1. Allgemeiner Teil, Systematischer Teil: 1. Scarabaeinae, 2. Coprinae (Pinotini, Coprini). Verlag der Tschechoslowakischen Akademie der Wissenschaften, Prag, 1963.[46] Y. Hanboonsong, K. Masumoto, T. Ochi, Dung beetles (Coleoptera, Scarabaeidae) of Thailand. Part 5. Genera Copris and Microcopris (Coprini), Elytra 31 (2003) 103-124.[47] D. Král, J. Rejsek, Synapsis naxiorum sp. n. from Yunnan (Coleoptera: Scarabaeidae), Acta Societatis Zoologicae Bohemicae 64 (2000) 267-270.[48] D. Král, Distribution and taxonomy of some Synapsis species, with description of S. strnadi sp. n. from Vietnam (Coleoptera: Scarabaeidae), Acta Societatis Zoologicae Bohemicae 66 (2002) 279-289.[49] T. Ochi, M. Kon, Notes on the coprophagous scarab beetles (Coleoptera, Scarabaeidae) from Southeast Asia (IV). A new horned species of Microcopris from Vietnam and a new subspecies of Copris erratus from Peleng off Sulawesi, Kogane 5 (2004) 25-30.[50] T. Ochi, M. Kon, H.T. Pham, Five new taxa of Copris (Coleoptera: Scarabaeidae) from Vietnam and Laos, Giornale Italiano di Entomologia 15 (64) (2019) 435-446.[51] T. Ochi, M. Kon, H.T. Pham, Two new species of Copris (Copris) (Coleoptera: Scarabaeidae) and a new subspecies of Phelotrupes (Sinogeotrupes) strnadi Král, Malý & Schneider (Coleoptera: Geotrupidae) from Vietnam, Giornale Italiano di Entomologia 15 (63) (2018) 159-168.[52] J. Zídek, S. Pokorný, Review of Synapsis Bates (Scarabaeidae: Scarabaeinae: Coprini), with description of a new species, Insecta Mundi 142 (2010) 1-21.[53] H.F. Howden, V.G. Nealis, Observations on height of perching in some tropical dung beetles (Scarabaeidae), Biotropica 10 (1978) 43-46. https://doi.org/10.1111/j.1752-4598.2009.00058.x.[54] T.H. Larsen, A. Lopera, A. Forsyth, Understanding trait-dependent community disassembly: Dung beetles, density functions, and forest fragmentation, Conservation Biology 22 (2008) 1288-1298. https://doi.org/10.1111/j.1523-1739.2008.00969.x.[55] S.B. Peck, A. Forsyth, Composition, structure, and competitive behaviour in a guild of Ecuadorian rain forest dung beetles (Coleoptera; Scarabaeidae), Canadian Journal of Zoology 60(7) (1982) 1624-1634. https://doi.org/10.1139/z82-213.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

This paper examines the manner of reconciling the concepts of Public Administration as a discipline and the contemporary actual realities in the Philippines as carried out by the National College of Public Administration and Governance of the University of the Philippines, Diliman. As a center of academic excellence and bestowed with the mandate of advancing nation-building into which utterance of identity is an implicit element, there is no other academic institution where expectations to advance the development of a ‘grounded’ public policy is so high than the said College. The paper studies the research direction of the NCPAG vis a vis its role in strengthening Philippine Public Administration both as discipline and praxis by developing approaches that are culturally and socially grounded in the Philippine society. The paper however limited its scrutiny to the epistemological element of the researches. Through content analysis, the article analyzed the theoretical frameworks used in the dissertations covered by the study and tries to answer the question of whether or not there is an attempt to develop, let alone to utilize in its analysis of phenomena, an indigenous theory. Initial results of the study had been juxtaposed to the academic orientation, research interests, and history of the College. References Books: Abueva, J. (1995). The Presidency and the Nation-State. In P. Tapales & N. Pilar (Eds.), Public Administration by the Year 2000: Looking Back into the Future (pp. 575-582). Quezon City: College of Public Administration. Abueva, J. (2007). From IPA to NCPAG: Some Reflections. In C. Alfiler (Ed.), Public Administration plus Governance: Assessing the Past, Addressing the Future (pp. 675-684). Quezon City: National College of Public Administration and Governance. Alfiler, M. C. Public Administration plus Governance: Assessing the Past, Addressing the Future. Quezon City: National College of Public Administration and Governance, 2007. Cariño, L. (2007). Traditional Public Administration to Governance: Research in NCPAG, 1952-2002, Public Administration plusGovernance: Assessing the Past, Addressing the Future (pp. 685-706). Quezon City:National College of Public Administration and Governance. Reyes, D. (1995). Life Begins at Forty: An Inquiry on Administrative Theory in the Philippines and the Structure of Scientific Revelations. In P. Tapales & N. Pilar (Eds.), Public Administration by the Year 2000: Looking Back into the Future (pp. 18-73). Quezon City: College of Public Administration. Tapales, P. & Pilar, N. Public Administration by the Year 2000: Looking Back into the Future. Quezon City: National College of Public Administration and Governance, 1995. Journal Articles: Abueva, J. “Ideals and Practice in the Study of Public Administration and Governance.” Philippine Journal of Public Administration 52, nos. 2-4 (2008): 119-138. Brillantes, A. & Fernandez, M. “Is There a Philippine Public Administration? Or Better Still For Whom is Philippines Public Administration.” Philipine Journal of Public Administration 52, nos. 2-4 (2008). Brillantes, A. & Fernandez, M. “Theory and Practice of Public Administration in the Philippines: Concerns for an Identity Crisis.” Asian Journal of Political Science 21, no. 1 (2013): 80-101. Brillantes, A. & Montes, R. “Federalism: Logical Step After Devolution?” Philippine Journal of Public Administration 51, nos. 1-4 (2007): 1-32. Cariño, L. “From Traditional Public Administration to Governance Tradition.” Philippine Journal of Public Administration 50, nos. 1-4 (2006): 1-22. Cariño, L. “Is There a Philippine Public Administration?” Philippine Journal of Public Administration 30, no. 4 (1986): 375-381. Corpuz, O. “Is There a Philippine Public Administration?” Philippine Journal of Public Administration 30, no. 4 (1986): 368-374. Dela Cruz, L. “Research Directions and Trajectory of the University of the Philippines Asian Center.” Scientia 4, no. 1 (2015): 48-67. Dela Cruz, L. “The Language of the Self: A Critical Assessment of Filipino Philosophy Theses Exploring the Filipino Self in University of the Philippines – Diliman.” Scientia 4, no. 2 (2015): 144-171. De Guzman, R. “Is There a Philippine Public Administration?.” Philippine Journal of Public Administration, 30, no. 4 (1986): 375-382. Domingo, M.O. “Indigenous Leadership and Governance.” Philippine Journal of Public Administration 48, nos. 1 & 2 (2004): 1-32. Englehart, J. “The Marriage between Theory and Practice.” Public Administration Review 61, no. 3 (2001): 371-374. Haque, M. S. “Theory and Practice of Public Administration in Southeast Asia: Traditions, Directions, and Impacts.” International Journal of Public Administration 30 (2007): 1297-1326. Hodder, R. “The Philippine Legislature and Social Relationships: Toward the Formalization of the Polity?” Philippine Studies 53, no. 4 (2005): 563-598. Llanera, T. “Ethnocentrism: Lessons from Richard Rorty to Randy David.” Philippine Sociological Review 65, special issue (2017): 135-149. Nolasco, L. “Prehistory and Early History of Philippine Public Administration.” Philippine Journal of Public Administration 55, nos. 1 & 2 (2011): 21-46. Penalosa, M. C. “Administrative Reform and Indigenization.” Philippine Journal of Public Administration 58, no. 2 (2014): 195-223. Rafael, E. “Philippine Problems are Problems of Modernity, Not of Transition.” Philippine Sociological Review 65, special issue (2017): 151-175. Reyes, D. “The Identity Crisis in Philippine Public Administration Revisited.” Philippine Journal of Public Administration 23, no. 1 (1979): 1-19. Reyes, D. “The Study of Administrative History: Philippine Public Administration as an Historical Discipline.” Philippine Journal of Public Administration 52, nos. 2-4 (2008). Ricote, E. “Philippine Public Administration as a Field of Study, Enduring and Emerging Areas, Challenges, and Prospects.” Philippine Journal of Public Administration 52, nos. 2- 4 (2008): 167-194. Sampaco-Baddiri, M. “New Institutionalism and Public Administration.” Philippine Journal of Public Administration 55, nos. 1 & 2 (2011): 1-20. Sto. Tomas, P. & Mangahas, J. “Public Administration and Governance.” Philippine Journal of Public Administration 50, nos. 1-4 (2006): 54-89. Thornhill, C. & Van Dijk, G. “Public Administration Theory: Justification for Conceptualisation.” Journal of Public Administration 45, no. 1.1 (2010): 95-110. Wilson, W. “The Study of Administration.” Political Science Quarterly 2, no. 2 (1887): 197-222. Unpublished Dissertations Abad-Sarmiento, L. (2005). An Assessment of the Administrative Capability of Local Governments in the National Capital Region in Implementing the Gender Mainstreaming Policy. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Abdon Jr., N.B. (November 2000). Religiosity, Ethical Practice and Performance: The Case of the Bureau of Internal Revenue. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Abdulrachman, S.M. (June 1991). The Relationship Between Religious Beliefs and Public Responsibility: A Case Study Among Maranao Muslim Public Administrators. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Alcid, R.G. (March 2007). E-Governance Perspective to Strengthen the Policy and Institutional Framework for ICT in the Philippines. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Ati, M.P. (December 1996). Process Assessment of the Implementation of Integrated Approach to Local Development Management in Davao City. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Bajao, A.R. (2009). Philippine Counterinsurgency Programs From Marcos to Arroyo: A Study in National Security Administration. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Bambalan, G.C. (2005). Elements of Sustainability in Philippine Forest Governance: An Analysis of the Community-Based Forest Management and Integrated Forest Management Programs in Isabela, Quirino, Aurora, and Negros Oriental, Philippines. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Bautista-Cruz, C. (April 2007). Strengthening Institutional Capacity for Disaster Reduction: The Cases of the Local Governments of Marikina, Pasig, and Pateros. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Boceta, N.M. (March 2003). The Development and Regulatory Functions of the Philippine Coconut Authority: 1973-2000. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Buendia, E.E. (May 2001). Democratizing Governance in the Philippines: Redefining and measuring the State of People’s Participation in Governance. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Caraan, H.S. (2010). Public-Private Sectors’ Role in the Clean Administration of Labor Justice: Transforming a Problematic Confluence into a Confluent Solution. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Carmona, C.V. (November 2003). Judicial Review of Economic Policies: Implications on Policymaking and Implementation. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Clavejo, L.A. (April 2008). Strategies for Crisis Management: The Responses of China to SARS and Avian Flu Pandemics and Lessons for the Philippines. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Co, E.A. (July 1997). Management Policy Formulation: The Generics Act of 1988. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Cuaresma, J.C. (April 13, 2008). Institutionalization of Geographic Information System for RPTA in Seven Philippine Local Government Units: Enabling and Hindering Factors. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Dimzon, C. (October 2003). An Evaluation of the Pre-Departure Orientation Seminar Program for Women Overseas Household Workers: Implications for Good Governance. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. De Vera III, J.E. (July 1999). A Comparative Study of Policy Decisions on Population Management in Selected Local Legislative Bodies in Pangasinan and Cebu. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Domingo, M.Z. (November 2004). Good Governance of Civil Society Organizations and the Role of Boards. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Domingo-Almase, A.D. (March 2007). A Saga of Administrative Thought in Presidential Rhetoric: An Analysis of the State of the Nation Addresses and Speeches of Philippine Presidents, 1935-2006. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Doncillo, H.V. (June 1995). Beneficiaries and Business Sector Participation, Administrative Capability and Effectiveness of a Solid Waste Management Service: The Case of Metro Cebu. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Dumrichob, S. (June 1990). An Assessment of a Rural Employment Program: The Case of the Program for Rural Employment Creation in Thailand. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Eclar, V.B. (April 1991). Analysis of Policies and Factors Affecting Successful Commercialization of Technologies. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Espinoza-Abadingo, L.M. (April 1990).The Administration of Elections in the Philippines: A Study of the Commission on Elections. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Ferrer, O.P. (May 2006). Community Governance: Understanding Community Processes and Initiatives. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Francisco, R.B. (March 2007). Sound Development Management in Urban Renewal and Slum Upgrading: The Case of National Government Center (West Side) Commonwealth Avenue, Quezon City. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Gaffud, R.B. (March 1995). Strengthening Market Leverage of People’s Enterprise and Promoting Self-Reliance: A Framework for Collaboration Between Cooperatives and Local Governments. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Garcia, J.G. (November 1995). Academe-Based Extension Services for Agricultural Development: A Study of the Administration of a Comprehensive UPLB Project. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Garcia Jr., M.F. (November 1995). Reorganization of the Philippine Fisheries Research System. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Gavino Jr., J.C. (1992). A Critical Study of the Regulation of the Telephone Utility: Some Options for Policy Development. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Genato-Rebullida, M.G. (April 1990). Church Development Perspective: Policy Formulation and Implementation. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Gonzales, B.V. (2009). The Development Promise of Corporate Social Responsibility in Education: Energy Development Corporation’s Role in Improving School Performance. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Gonzales, E. (1972-1990). The Philippine Agrarian Reform Program. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Hofer, D.K. (April 2005). Local Government Unit Bond Flotation for Financing Development in the Philippine Setting: Case Studies and Vital Lessons Learned. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Imdad, M.P. (2010). Dynamics and Perspectives of Aid Management in the Philippines: Achievements, Challenges, and the Way Forward. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Jimenez, G.P. (2005). Selected Credit Programs for Farmer-Based Postharvest Enterprise: An Assessment. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Lamarca, F.J. (April 1992). The Tobacco Contract Growing Project of the National Tobacco Administration in the Province of La Union: An Assessment of Administrative Capability, Participation, Trading Practices and Effectiveness. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Legaspi, P.E. (March 1990). The Genesis, Viability, and Effectiveness of Community Organizations: The Case of Pangasinan Credit Cooperatives. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Legayada, B.L. (October 1992). Career Advancement of Women Managers in the Philippine Bureaucracy: A Case Study of Region VI. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Librea, R.C. (January 2010). Mainstreaming Human Rights-Based Approach in Selected Development and Governance Projects. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Macaayong, H.W. (May 1992). Small and Medium Enterprises Development: A Study on Program Administration and Effectiveness in the Province of Lanao Del Sur. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Mallari, N.H. (1994). Political Economy of Philippine Public Enterprises. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Maxino-Yorobe, G.A. (November 1995). Administrative Factors in Agricultural R and D Projects. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Legaspi, P.E. (March 1990). The Genesis, Viability, and Effectiveness of Community Organizations: The Case of Pangasinan Credit Cooperatives. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Morato, E.A. (2004). Policies and Strategies for Promoting Entrepreneurship and Enterprise Development. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Moreno, F. (2004). Good Governance in Microcredit Strategy for Poverty Reduction: Focus on Western Mindanao. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Navarro, R.L. (April 1992). Public-Private Partnership in Development Administration: GO-NGO Collaboration in Agricultural Development. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Noval, M.G. (June 1994). Measuring and Accessing the Quality, Equity, and Efficiency of Public Hospitals in the Philippines. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Ogbinar, E.R. (1990). The Role of Government in the Development of the Philippine Maritime Industry and in the Promotion of Maritime Safety. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Oguejiofor, A.C. (March 2010). Challenges to Microfinance as a Poverty Reduction Strategy: Evidences from the Philippines. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Ortiz, J.I. (March 2002). Participatory Development Planning; The Bondoc Development Program Experience. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Paje, R.P. (June 1999). Decentralizing Philippine Environment and Natural Resources Management: An Analysis of the Devolution of Community-Based Upland Development Programs. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Panganiban, E.M. (1990). Toward a Democratic-Efficient Framework of Local Government in the Philippines: Some Policy Criteria. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Prakash, I.G. (October 2006). Partnership Among Government, Private Sector and Civil Society: Improving Services in the Philippine Disability Sector. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Pujiono (1998). An Assessment of the Administrative Capability for Disaster Preparedness of Three Municipalities. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Reyes, D. (June 1995). A Search for Heritage. An Analysis of Trends and Content of Public Administration Literature at UP College of Public Administration, 1952-1992. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Reyes, J.C. (June 1993). Administration for Research Utilization: An Analysis of Five Agricultural Research Organizations. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Reyes, R.E. (October 2008). Corporate Governance and the Clark Development Corporation: A Case Study. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Rodriguez, A.S. (October 2001). An Operational Model to Institutionalize Knowledge Management in the Philippines: Lessons on Knowledge Management Practices From the 5th Countryn Programme for Children. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Rodriguez, M.P. (June 2002). A Privatized Corporation in Transition: A Study of Organization Culture. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Salvosa, C.R. (April 2007). Assessing Governance Performance of Selected Primary Cooperatives in the Philippines. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Sam, R.A. (2002). Farmers’ Cooperatives in Conflict-Ridden Areas: The Maguindanao Experience. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Sanchez, L.V. (July 1990). The Katarungang Pambarangay: Justice at the Grassroots. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Serrano, C.P. (June 1990). The Administrative Capacity of the Iskolar ng Bayan Program (STFAP): An early evaluation. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Serrano, D.J. (July 2005). Dynamics of Policy Formulation: The Passage of the Ecological Solid Waste Management Act. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Serrona, E.R. (October 1992). The Northern Samar Integrated Rural Development Project: A Study in Rural Development Administration. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Sonsri, G. (October 2005). Analysis of Motivational Factors Influencing the Performance of Municipal Government Employees in Public Service Delivery: The Case of Two Selected Metropolitan Municipalities in Thailand. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Subramanian, K.S. (June 1993). Financial Administration of Indian Railways. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Swaminathan, R. (July 1993). State Interventions in Integrated Urban Development: A Study of the Program, Resource, and Institutional Dimensions of Two ADB Assisted Projects in Indonesia. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Tabion, G.S. (March 1993). The Capability of the Barangay as a Management Unit to Absorb Devolved Functions: Case Studies of 15 Barangays in the Province of Tarlac. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Tabunda Jr., C.C. (2010). The Comprehensive Agrarian Reform Program: The Experiences of Three Municipalities in Cavite – Challenges and Future Directions. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Tanggol, S.D. (November 1992). Autonomous Region in Muslim Mindanao: Towards a More Effective, Responsive, and Implementable Policy. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Tigno, J.V. (October 2003). Governance and Public Policy in the Philippines: RA 8042 and the Deregulation of the Overseas Employment Sector. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Torres, J.I. (April 2007). Socially Responsible Improvements in Working Conditions: Implications on Policy and Programs. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Villamejor-Mendoza, M.V. (October 2003). Regulation in the Philippine Electricity Industry: Lessons of the Past and Implications on Governance. (Unpublished doctoral dissertation). University of the Philippines, Quezon City, Philippines. Electronic Source: NCPAG. (n.d.). National College of Public Administration and Governance History. Retrieved November 30, 2019, from http://www.ncpag.up.edu.ph

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Introduction Eating is one of the most quintessential activities of human life. Because of this primacy, eating is, as food anthropologist Sidney Mintz has observed, “not merely a biological activity, but a vibrantly cultural activity as well” (48). This article posits that the current awareness of climate change in the Western world is animating such cultural activity as the Slow Food movement and is, as a result, stimulating what could be seen as an evolutionary change in popular foodways. Moreover, this paper suggests that, in line with modelling provided by the Slow Food example, an increased awareness of the connections of climate change to the social injustices of food production might better drive social change in such areas. This discussion begins by proposing that contemporary foodways—defined as “not only what is eaten by a particular group of people but also the variety of customs, beliefs and practices surrounding the production, preparation and presentation of food” (Davey 182)—are changing in the West in relation to current concerns about climate change. Such modification has a long history. Since long before the inception of modern hom*o sapiens, natural climate change has been a crucial element driving hominidae evolution, both biologically and culturally in terms of social organisation and behaviours. Macroevolutionary theory suggests evolution can dramatically accelerate in response to rapid shifts in an organism’s environment, followed by slow to long periods of stasis once a new level of sustainability has been achieved (Gould and Eldredge). There is evidence that ancient climate change has also dramatically affected the rate and course of cultural evolution. Recent work suggests that the end of the last ice age drove the cultural innovation of animal and plant domestication in the Middle East (Zeder), not only due to warmer temperatures and increased rainfall, but also to a higher level of atmospheric carbon dioxide which made agriculture increasingly viable (McCorriston and Hole, cited in Zeder). Megadroughts during the Paleolithic might well have been stimulating factors behind the migration of hominid populations out of Africa and across Asia (Scholz et al). Thus, it is hardly surprising that modern anthropogenically induced global warming—in all its’ climate altering manifestations—may be driving a new wave of cultural change and even evolution in the West as we seek a sustainable homeostatic equilibrium with the environment of the future. In 1962, Rachel Carson’s Silent Spring exposed some of the threats that modern industrial agriculture poses to environmental sustainability. This prompted a public debate from which the modern environmental movement arose and, with it, an expanding awareness and attendant anxiety about the safety and nutritional quality of contemporary foods, especially those that are grown with chemical pesticides and fertilizers and/or are highly processed. This environmental consciousness led to some modification in eating habits, manifest by some embracing wholefood and vegetarian dietary regimes (or elements of them). Most recently, a widespread awareness of climate change has forced rapid change in contemporary Western foodways, while in other climate related areas of socio-political and economic significance such as energy production and usage, there is little evidence of real acceleration of change. Ongoing research into the effects of this expanding environmental consciousness continues in various disciplinary contexts such as geography (Eshel and Martin) and health (McMichael et al). In food studies, Vileisis has proposed that the 1970s environmental movement’s challenge to the polluting practices of industrial agri-food production, concurrent with the women’s movement (asserting women’s right to know about everything, including food production), has led to both cooks and eaters becoming increasingly knowledgeable about the links between agricultural production and consumer and environmental health, as well as the various social justice issues involved. As a direct result of such awareness, alternatives to the industrialised, global food system are now emerging (Kloppenberg et al.). The Slow Food (R)evolution The tenets of the Slow Food movement, now some two decades old, are today synergetic with the growing consternation about climate change. In 1983, Carlo Petrini formed the Italian non-profit food and wine association Arcigola and, in 1986, founded Slow Food as a response to the opening of a McDonalds in Rome. From these humble beginnings, which were then unashamedly positing a return to the food systems of the past, Slow Food has grown into a global organisation that has much more future focused objectives animating its challenges to the socio-cultural and environmental costs of industrial food. Slow Food does have some elements that could be classed as reactionary and, therefore, the opposite of evolutionary. In response to the increasing hom*ogenisation of culinary habits around the world, for instance, Slow Food’s Foundation for Biodiversity has established the Ark of Taste, which expands upon the idea of a seed bank to preserve not only varieties of food but also local and artisanal culinary traditions. In this, the Ark aims to save foods and food products “threatened by industrial standardization, hygiene laws, the regulations of large-scale distribution and environmental damage” (SFFB). Slow Food International’s overarching goals and activities, however, extend far beyond the preservation of past foodways, extending to the sponsoring of events and activities that are attempting to create new cuisine narratives for contemporary consumers who have an appetite for such innovation. Such events as the Salone del Gusto (Salon of Taste) and Terra Madre (Mother Earth) held in Turin every two years, for example, while celebrating culinary traditions, also focus on contemporary artisanal foods and sustainable food production processes that incorporate the most current of agricultural knowledge and new technologies into this production. Attendees at these events are also driven by both an interest in tradition, and their own very current concerns with health, personal satisfaction and environmental sustainability, to change their consumer behavior through an expanded self-awareness of the consequences of their individual lifestyle choices. Such events have, in turn, inspired such events in other locations, moving Slow Food from local to global relevance, and affecting the intellectual evolution of foodway cultures far beyond its headquarters in Bra in Northern Italy. This includes in the developing world, where millions of farmers continue to follow many traditional agricultural practices by necessity. Slow Food Movement’s forward-looking values are codified in the International Commission on the Future of Food and Agriculture 2006 publication, Manifesto on the Future of Food. This calls for changes to the World Trade Organisation’s rules that promote the globalisation of agri-food production as a direct response to the “climate change [which] threatens to undermine the entire natural basis of ecologically benign agriculture and food preparation, bringing the likelihood of catastrophic outcomes in the near future” (ICFFA 8). It does not call, however, for a complete return to past methods. To further such foodway awareness and evolution, Petrini founded the University of Gastronomic Sciences at Slow Food’s headquarters in 2004. The university offers programs that are analogous with the Slow Food’s overall aim of forging sustainable partnerships between the best of old and new practice: to, in the organisation’s own words, “maintain an organic relationship between gastronomy and agricultural science” (UNISG). In 2004, Slow Food had over sixty thousand members in forty-five countries (Paxson 15), with major events now held each year in many of these countries and membership continuing to grow apace. One of the frequently cited successes of the Slow Food movement is in relation to the tomato. Until recently, supermarkets stocked only a few mass-produced hybrids. These cultivars were bred for their disease resistance, ease of handling, tolerance to artificial ripening techniques, and display consistency, rather than any culinary values such as taste, aroma, texture or variety. In contrast, the vine ripened, ‘farmer’s market’ tomato has become the symbol of an “eco-gastronomically” sustainable, local and humanistic system of food production (Jordan) which melds the best of the past practice with the most up-to-date knowledge regarding such farming matters as water conservation. Although the term ‘heirloom’ is widely used in relation to these tomatoes, there is a distinctively contemporary edge to the way they are produced and consumed (Jordan), and they are, along with other organic and local produce, increasingly available in even the largest supermarket chains. Instead of a wholesale embrace of the past, it is the connection to, and the maintenance of that connection with, the processes of production and, hence, to the environment as a whole, which is the animating premise of the Slow Food movement. ‘Slow’ thus creates a gestalt in which individuals integrate their lifestyles with all levels of the food production cycle and, hence to the environment and, importantly, the inherently related social justice issues. ‘Slow’ approaches emphasise how the accelerated pace of contemporary life has weakened these connections, while offering a path to the restoration of a sense of connectivity to the full cycle of life and its relation to place, nature and climate. In this, the Slow path demands that every consumer takes responsibility for all components of his/her existence—a responsibility that includes becoming cognisant of the full story behind each of the products that are consumed in that life. The Slow movement is not, however, a regime of abstention or self-denial. Instead, the changes in lifestyle necessary to support responsible sustainability, and the sensual and aesthetic pleasure inherent in such a lifestyle, exist in a mutually reinforcing relationship (Pietrykowski 2004). This positive feedback loop enhances the potential for promoting real and long-term evolution in social and cultural behaviour. Indeed, the Slow zeitgeist now informs many areas of contemporary culture, with Slow Travel, Homes, Design, Management, Leadership and Education, and even Slow Email, Exercise, Shopping and Sex attracting adherents. Mainstreaming Concern with Ethical Food Production The role of the media in “forming our consciousness—what we think, how we think, and what we think about” (Cunningham and Turner 12)—is self-evident. It is, therefore, revealing in relation to the above outlined changes that even the most functional cookbooks and cookery magazines (those dedicated to practical information such as recipes and instructional technique) in Western countries such as the USA, UK and Australian are increasingly reflecting and promoting an awareness of ethical food production as part of this cultural change in food habits. While such texts have largely been considered as useful but socio-politically relatively banal publications, they are beginning to be recognised as a valid source of historical and cultural information (Nussel). Cookbooks and cookery magazines commonly include discussion of a surprising range of issues around food production and consumption including sustainable and ethical agricultural methods, biodiversity, genetic modification and food miles. In this context, they indicate how rapidly the recent evolution of foodways has been absorbed into mainstream practice. Much of such food related media content is, at the same time, closely identified with celebrity mass marketing and embodied in the television chef with his or her range of branded products including their syndicated articles and cookbooks. This commercial symbiosis makes each such cuisine-related article in a food or women’s magazine or cookbook, in essence, an advertorial for a celebrity chef and their named products. Yet, at the same time, a number of these mass media food celebrities are raising public discussion that is leading to consequent action around important issues linked to climate change, social justice and the environment. An example is Jamie Oliver’s efforts to influence public behaviour and government policy, a number of which have gained considerable traction. Oliver’s 2004 exposure of the poor quality of school lunches in Britain (see Jamie’s School Dinners), for instance, caused public outrage and pressured the British government to commit considerable extra funding to these programs. A recent study by Essex University has, moreover, found that the academic performance of 11-year-old pupils eating Oliver’s meals improved, while absenteeism fell by 15 per cent (Khan). Oliver’s exposé of the conditions of battery raised hens in 2007 and 2008 (see Fowl Dinners) resulted in increased sales of free-range poultry, decreased sales of factory-farmed chickens across the UK, and complaints that free-range chicken sales were limited by supply. Oliver encouraged viewers to lobby their local councils, and as a result, a number banned battery hen eggs from schools, care homes, town halls and workplace cafeterias (see, for example, LDP). The popular penetration of these ideas needs to be understood in a historical context where industrialised poultry farming has been an issue in Britain since at least 1848 when it was one of the contributing factors to the establishment of the RSPCA (Freeman). A century after Upton Sinclair’s The Jungle (published in 1906) exposed the realities of the slaughterhouse, and several decades since Peter Singer’s landmark Animal Liberation (1975) and Tom Regan’s The Case for Animal Rights (1983) posited the immorality of the mistreatment of animals in food production, it could be suggested that Al Gore’s film An Inconvenient Truth (released in 2006) added considerably to the recent concern regarding the ethics of industrial agriculture. Consciousness-raising bestselling books such as Jim Mason and Peter Singer’s The Ethics of What We Eat and Michael Pollan’s The Omnivore’s Dilemma (both published in 2006), do indeed ‘close the loop’ in this way in their discussions, by concluding that intensive food production methods used since the 1950s are not only inhumane and damage public health, but are also damaging an environment under pressure from climate change. In comparison, the use of forced labour and human trafficking in food production has attracted far less mainstream media, celebrity or public attention. It could be posited that this is, in part, because no direct relationship to the environment and climate change and, therefore, direct link to our own existence in the West, has been popularised. Kevin Bales, who has been described as a modern abolitionist, estimates that there are currently more than 27 million people living in conditions of slavery and exploitation against their wills—twice as many as during the 350-year long trans-Atlantic slave trade. Bales also chillingly reveals that, worldwide, the number of slaves is increasing, with contemporary individuals so inexpensive to purchase in relation to the value of their production that they are disposable once the slaveholder has used them. Alongside sex slavery, many other prevalent examples of contemporary slavery are concerned with food production (Weissbrodt et al; Miers). Bales and Soodalter, for example, describe how across Asia and Africa, adults and children are enslaved to catch and process fish and shellfish for both human consumption and cat food. Other campaigners have similarly exposed how the cocoa in chocolate is largely produced by child slave labour on the Ivory Coast (Chalke; Off), and how considerable amounts of exported sugar, cereals and other crops are slave-produced in certain countries. In 2003, some 32 per cent of US shoppers identified themselves as LOHAS “lifestyles of health and sustainability” consumers, who were, they said, willing to spend more for products that reflected not only ecological, but also social justice responsibility (McLaughlin). Research also confirms that “the pursuit of social objectives … can in fact furnish an organization with the competitive resources to develop effective marketing strategies”, with Doherty and Meehan showing how “social and ethical credibility” are now viable bases of differentiation and competitive positioning in mainstream consumer markets (311, 303). In line with this recognition, Fair Trade Certified goods are now available in British, European, US and, to a lesser extent, Australian supermarkets, and a number of global chains including Dunkin’ Donuts, McDonalds, Starbucks and Virgin airlines utilise Fair Trade coffee and teas in all, or parts of, their operations. Fair Trade Certification indicates that farmers receive a higher than commodity price for their products, workers have the right to organise, men and women receive equal wages, and no child labour is utilised in the production process (McLaughlin). Yet, despite some Western consumers reporting such issues having an impact upon their purchasing decisions, social justice has not become a significant issue of concern for most. The popular cookery publications discussed above devote little space to Fair Trade product marketing, much of which is confined to supermarket-produced adverzines promoting the Fair Trade products they stock, and international celebrity chefs have yet to focus attention on this issue. In Australia, discussion of contemporary slavery in the press is sparse, having surfaced in 2000-2001, prompted by UNICEF campaigns against child labour, and in 2007 and 2008 with the visit of a series of high profile anti-slavery campaigners (including Bales) to the region. The public awareness of food produced by forced labour and the troubling issue of human enslavement in general is still far below the level that climate change and ecological issues have achieved thus far in driving foodway evolution. This may change, however, if a ‘Slow’-inflected connection can be made between Western lifestyles and the plight of peoples hidden from our daily existence, but contributing daily to them. Concluding Remarks At this time of accelerating techno-cultural evolution, due in part to the pressures of climate change, it is the creative potential that human conscious awareness brings to bear on these challenges that is most valuable. Today, as in the caves at Lascaux, humanity is evolving new images and narratives to provide rational solutions to emergent challenges. As an example of this, new foodways and ways of thinking about them are beginning to evolve in response to the perceived problems of climate change. The current conscious transformation of food habits by some in the West might be, therefore, in James Lovelock’s terms, a moment of “revolutionary punctuation” (178), whereby rapid cultural adaption is being induced by the growing public awareness of impending crisis. It remains to be seen whether other urgent human problems can be similarly and creatively embraced, and whether this trend can spread to offer global solutions to them. References An Inconvenient Truth. Dir. Davis Guggenheim. Lawrence Bender Productions, 2006. Bales, Kevin. Disposable People: New Slavery in the Global Economy. Berkeley: University of California Press, 2004 (first published 1999). Bales, Kevin, and Ron Soodalter. The Slave Next Door: Human Trafficking and Slavery in America Today. Berkeley: University of California Press, 2009. Carson, Rachel. Silent Spring. Boston: Houghton Mifflin, 1962. Chalke, Steve. “Unfinished Business: The Sinister Story behind Chocolate.” The Age 18 Sep. 2007: 11. Cunningham, Stuart, and Graeme Turner. The Media and Communications in Australia Today. Crows Nest: Allen & Unwin, 2002. Davey, Gwenda Beed. “Foodways.” The Oxford Companion to Australian Folklore. Ed. Gwenda Beed Davey, and Graham Seal. Melbourne: Oxford University Press, 1993. 182–85. Doherty, Bob, and John Meehan. “Competing on Social Resources: The Case of the Day Chocolate Company in the UK Confectionery Sector.” Journal of Strategic Marketing 14.4 (2006): 299–313. Eshel, Gidon, and Pamela A. Martin. “Diet, Energy, and Global Warming.” Earth Interactions 10, paper 9 (2006): 1–17. Fowl Dinners. Exec. Prod. Nick Curwin and Zoe Collins. Dragonfly Film and Television Productions and Fresh One Productions, 2008. Freeman, Sarah. Mutton and Oysters: The Victorians and Their Food. London: Gollancz, 1989. Gould, S. J., and N. Eldredge. “Punctuated Equilibrium Comes of Age.” Nature 366 (1993): 223–27. (ICFFA) International Commission on the Future of Food and Agriculture. Manifesto on the Future of Food. Florence, Italy: Agenzia Regionale per lo Sviluppo e l’Innovazione nel Settore Agricolo Forestale and Regione Toscana, 2006. Jamie’s School Dinners. Dir. Guy Gilbert. Fresh One Productions, 2005. Jordan, Jennifer A. “The Heirloom Tomato as Cultural Object: Investigating Taste and Space.” Sociologia Ruralis 47.1 (2007): 20-41. Khan, Urmee. “Jamie Oliver’s School Dinners Improve Exam Results, Report Finds.” Telegraph 1 Feb. 2009. 24 Aug. 2009 < http://www.telegraph.co.uk/education/educationnews/4423132/Jamie-Olivers-school-dinners-improve-exam-results-report-finds.html >. Kloppenberg, Jack, Jr, Sharon Lezberg, Kathryn de Master, G. W. Stevenson, and John Henrickson. ‘Tasting Food, Tasting Sustainability: Defining the Attributes of an Alternative Food System with Competent, Ordinary People.” Human Organisation 59.2 (Jul. 2000): 177–86. (LDP) Liverpool Daily Post. “Battery Farm Eggs Banned from Schools and Care Homes.” Liverpool Daily Post 12 Jan. 2008. 24 Aug. 2009 < http://www.liverpooldailypost.co.uk/liverpool-news/regional-news/2008/01/12/battery-farm-eggs-banned-from-schools-and-care-homes-64375-20342259 >. Lovelock, James. The Ages of Gaia: A Biography of Our Living Earth. New York: Bantam, 1990 (first published 1988). Mason, Jim, and Peter Singer. The Ethics of What We Eat. Melbourne: Text Publishing, 2006. McLaughlin, Katy. “Is Your Grocery List Politically Correct? Food World’s New Buzzword Is ‘Sustainable’ Products.” The Wall Street Journal 17 Feb. 2004. 29 Aug. 2009 < http://www.globalexchange.org/campaigns/fairtrade/coffee/1732.html >. McMichael, Anthony J, John W Powles, Colin D Butler, and Ricardo Uauy. “Food, Livestock Production, Energy, Climate Change, and Health.” The Lancet 370 (6 Oct. 2007): 1253–63. Miers, Suzanne. “Contemporary Slavery”. A Historical Guide to World Slavery. Ed. Seymour Drescher, and Stanley L. Engerman. New York: Oxford University Press, 1998. Mintz, Sidney W. Tasting Food, Tasting Freedom: Excursions into Eating, Culture, and the Past. Boston: Beacon Press, 1994. Nussel, Jill. “Heating Up the Sources: Using Community Cookbooks in Historical Inquiry.” History Compass 4/5 (2006): 956–61. Off, Carol. Bitter Chocolate: Investigating the Dark Side of the World's Most Seductive Sweet. St Lucia: U of Queensland P, 2008. Paxson, Heather. “Slow Food in a Fat Society: Satisfying Ethical Appetites.” Gastronomica: The Journal of Food and Culture 5.1 (2005): 14–18. Pietrykowski, Bruce. “You Are What You Eat: The Social Economy of the Slow Food Movement.” Review of Social Economy 62:3 (2004): 307–21. Pollan, Michael. The Omnivore’s Dilemma: A Natural History of Four Meals. New York: The Penguin Press, 2006. Regan, Tom. The Case for Animal Rights. Berkeley: University of California Press, 1983. Scholz, Christopher A., Thomas C. Johnson, Andrew S. Cohen, John W. King, John A. Peck, Jonathan T. Overpeck, Michael R. Talbot, Erik T. Brown, Leonard Kalindekafe, Philip Y. O. Amoako, Robert P. Lyons, Timothy M. Shanahan, Isla S. Castañeda, Clifford W. Heil, Steven L. Forman, Lanny R. McHargue, Kristina R. Beuning, Jeanette Gomez, and James Pierson. “East African Megadroughts between 135 and 75 Thousand Years Ago and Bearing on Early-modern Human Origins.” PNAS: Proceedings of the National Academy of the Sciences of the United States of America 104.42 (16 Oct. 2007): 16416–21. Sinclair, Upton. The Jungle. New York: Doubleday, Jabber & Company, 1906. Singer, Peter. Animal Liberation. New York: HarperCollins, 1975. (SFFB) Slow Food Foundation for Biodiversity. “Ark of Taste.” 2009. 24 Aug. 2009 < http://www.fondazioneslowfood.it/eng/arca/lista.lasso >. (UNISG) University of Gastronomic Sciences. “Who We Are.” 2009. 24 Aug. 2009 < http://www.unisg.it/eng/chisiamo.php >. Vileisis, Ann. Kitchen Literacy: How We Lost Knowledge of Where Food Comes From and Why We Need to Get It Back. Washington: Island Press/Shearwater Books, 2008. Weissbrodt, David, and Anti-Slavery International. Abolishing Slavery and its Contemporary Forms. New York and Geneva: Office of the United Nations High Commissioner for Human Rights, United Nations, 2002. Zeder, Melinda A. “The Neolithic Macro-(R)evolution: Macroevolutionary Theory and the Study of Culture Change.” Journal of Archaeological Research 17 (2009): 1–63.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

The article presents the preliminary results of the interdisciplinary research (geological and geospatial studies, archaeological excavations, salt production experiments, and ethnographic survey) carried out during 2016-2019, in the site and hybrid saltscape of Băile Figa, well known for its remarkable environmental, ancient and current salt exploitation evidence. Besides, the article aims to evaluate the contribution of the recent research to a better understanding of the environmental context of the site and ancient salt production technology in the Inner Carpathian region. Also, it focuses on the hybrid character of the site and its potential to the transdisciplinary and holistic study. Environmental context. The site is rich in environmental, archaeological and ethnographic evidence. It is positioned in the salt-rich area of the Someșul Mare Basin at the northern edge of the Transylvanian Plain (Fig. 1/2; 2/1). The site is part of the landscape that was and is strongly affected by the dynamics of a salt diapir (Fig. 2/2) and deposits of salt mud, brine and halo-biotic factors, as well as by the intense human activity. Excavation. The excavation was carried out in Trench S.XV (16 m x 14 m), located in the central-southern sector of the site. The trench cut through the stream-bed and steep and high banks of the salt stream that crosses the site from south to north (Fig. 4; 5, 10). Its profile sections show four major stratigraphic units: a blackish topsoil, yellow clay mixed with gravel, salty mud, and the rock salt massif. The excavation was conducted in the mud layer, in the central sector of the trench, and in the clay-and-gravel layer found in its lateral sectors. In the area of ca. 60 square meters of the central sector, the excavation has reached the rock salt massif (Fig. 7-11). The excavation in the trench has uncovered rich evidence for Late Bronze Age salt production: seven interconnected features and around one hundred artifacts. The vast majority of the finds have been uncovered in the mud layer. The uncovered features included five timber structures surviving in the salt mud layer, as well as a ditch and a pit dug in the rock salt massif. Feature 1-XV-2013 (Fig. 12; 14/1) is a structure that includes a cone-shaped wattle-lined pit surrounded by a roundish wattle-made fence. The pit cuts through the mud up to the rock salt massif. Its rock salt bottom was sectioned by a ditch, 0.4-0.5 m wide and over 0.9 m deep. It seems that first, by rather extensive digging, the soil and mud were removed down to the salt massif. Then, a ditch, about 5 m long, 0.4 m wide and over 0.9 m deep (see below), was dug in the rock, from east to west. After that, a cone-shaped outer framework made of wattle (D maximal: 1.2 m, D minimal: 0.4 m, H: 1.8 m) was placed over the ditch, narrow end down. After that, the empty space around the framework was filled with mud. Then the pit was surrounded by a roundish wattle fence. A 1.6 m long massive rope made of three twisted threads (Clematis vitalba) has been found in the ditch (Fig. 41). Four samples taken from the wattle framework have produced five dates which fall between 2821±24 and 2778±26 BP. Feature 2-XV-2013 (Fig. 13) was uncovered in the northern part of the trench, on the right side of the stream, between feature 1-XV-2013 (see above) and the north edge of the trench. It was a rectilinear fence, 3.6 m long, built of vertical planks, split troughs, and channelled pieces, pushed into the mud down to the rock salt massif. Three fragments of the troughs from the fence were dendrochronologically dated to the period between 996 and 980 BC. Feature 1-XV-2015 (Fig. 14) was uncovered in the central-southern part of the trench. It was a corridor, 2.5 m long and 1 m wide, oriented E – W, made of two parallel rectilinear alignments of massive upright poles driven into the mud. One of its poles was at the same time part of the fence of the Feature 1-XV-2013. The corridor, on the base of three samples, has been radiocarbon-dated between 2870±32 and 2718±30 BP. Feature 1-XV-2018 (Fig. 15-17) was partially uncovered in the north-west part of the trench, about 3.5 m west of the stream. It is a 5 m long fence, oriented S – N, made of vertical planks, stakes (Fig. 17/2), and a split trough (Fig. 17/1), stuck into the mud, and four horizontal planks linking them to each other (Fig.17/2). Not dated. Feature 2-XV-2018 (Fig. 18; 19/1) was partially uncovered in the western part of the trench, in the rock salt massif. It is a roundish pit (over 2.5 x 1.8 m) with irregular edges, ca. 1.7 m deep below the salt massif surface. Not dated. Feature 3-XV-2018 (Fig. 19; 20) was uncovered in the central part of the trench. It was a ditch dug in the salt massif, 0.4 to 0.8 m wide, over 0.9 m deep, and about 4 m long. It cuts through the bottom of feature 1-XV-2013 (Fig. 12/2) and links it to the feature 2-XV-2018. Not dated. Feature 4-XV-2018 (Fig. 19/1; 20-22) was uncovered in the south-east corner of the trench, covering about 4 x 4 m, and consisted of a cluster of parallel beams laying on the salt massif, and a few vertical poles. The feature continues eastwards and southwards beyond the sides of the trench. On the base of three samples, it was radiocarbon-dated between 2856±31 and 2817±30 BP. Artifacts. We found some 100 artifacts in Trench S.XV during the excavation seasons, between 2016 and 2019. Most of them were made of wood, 1 of hemp (?), and 3 of stone (basalt). The wooden artifacts include 31 component pieces and fragments of trough bodies (Fig. 24-27), 17 channelled pieces (Fig. 28-30), 2 shovels (Fig. 33), 12 paddles (Fig. 31; 32), 4 mallets (Fig. 34/2,3), an L-shaped haft for a socketedaxe (Fig. 34/1), 2 pans (Fig. 35), a bowl (Fig. 36), fragments of 2 ladders (Fig. 37), 3 knife-shaped tools (Fig. 38/2,3), 11 rods with pointed end (Fig. 38/4), 4 loops made of twisted twigs (Fig. 40), a massive rope made of three twisted threads (Clematis vitalba) (Fig. 41), and 5 wedges. One of the artifacts found was made of plant material, possibly hemp: a small twisted cord (it may come from a peg inserted in the trough hole). Stone (basalt) artifacts include 2 mining hammers (mining tools) with engraved grooves aimed to fix the bindings (Fig. 44/1,3), an ovoid-shaped object with many percussion marks at its thicker end (Fig. 44/2). The chronology of the finds. In 2018 4 samples (wattle) from the Feature 1-XV-2013 were dated at Oxford University Research Laboratory for Archaeology and the History of Art / Radiocarbon Accelerator Unit. In 2019 some of the timber features (1-XV-2015 and 4-XV-2018) and wooden artifacts (the ladder, the troughs nos. 4 and 5 and some others) were radiocarbon dated by “Horia Hulubei” National Institute for Research and Development in Physics and Nuclear Engineering. Most of the dates fall between 1000 – 900 cal BC. Just one date (a wooden bowl) falls between ca. 1419-1262 cal BC (Tabels 1, 2, 3). The structures and most of the artifacts uncovered in S.XV date to ca. XI-IX centuries cal BC and seem to have been part of a complex production system aimed at brine and rock salt processing. Differential distribution of finds across the site. The research has revealed differential distribution of finds across the site. Thus, the evidence dating to ca. 2300 – 2000 cal BC (a pit dug in the rock massif and pottery), 1600 – 1400 cal BC (a wattle-built structure and wooden troughs), and 400 – 180 cal BC (timber-lined shaft, a wooden ladder and pottery) is mainly concentrated in the southern sector of the site. In exchange, the finds dating to ca. 1400 – 1100 cal BC have mainly been uncovered in the south-central part of the site (timber structures) and northern part of the site (pottery). The evidence dating to about 1050 – 850 cal BC covers two distinct areas: the south-central and northern sectors of the site. While about thirty fragmented troughs have been found in the south-central sector, no one object of this kind has been found in the northern sector. There are also differences concerning the timber structures between these sectors of the site. These strongly suggest that in XI – IX centuries cal BC, at least two different and complementary production areas were active in the site. Salt production experiments. The experiments on salt production, using faithful replicas of Late Bronze Age artifacts uncovered in trenches S.I and S.XV – troughs, channelled pieces, mallets, wedges, stone mining hammers, etc. – aimed to obtain from the different source material – rock salt massif, brine, and mud – various forms of salt: lumps of rock salt, fine salt, and highly concentrated and pure brine. The experiments showed the technical validity of several techniques. The most effective were as follows: 1. Detaching lumps of rock salt from the massif. By means of jets of fresh water directed with the troughs (along the twisted cords fitted in the perforations of the sticks that went through the pegs which were fixed in the holes at the base of the trough) depressions were simultaneously created in the rock salt at ten to twenty spots, 10 to 15 cm apart and 7 to 12 cm deep. This process took few hours (Fig. 45/1). It was noticed that each hole generated one to three cracks in the salt massif, around 1 m long and 5 to 10 cm deep. The holes and cracks allowed the insertion of wooden wedges. By hitting them with heavy wooden mallets, the wedges were pushed down to ca. 20 cm deep. Finally, using hooked sticks, many blocks of rock salt could be detached from the massif. The larger blocks were easily broken by stone hammers (mining tools). 2. Producing small pieces of salt and fine salt from the rock salt massif. The first stages of the process were identical to the previously described. After the holes and cracks were created, the rock salt mass was beaten with stone hammers (mining tools) along the cracks and holes, so that small pieces of salt, as well as wet and soft fine salt, were easily separated from the mass. Thus, about 50 kilograms of fine salt were collected in 30 minutes during the experiment (Fig. 45/2). 3. Boiling brine in the troughs with hot stones and drawing off the brine. Stones heated as much as possible in a fire were immersed in the brine with which the trough was filled, thus bringing it to the boil (Fig. 46). The boiling continued until the salt begun to crystallize. After that, the trough, full of highly concentrated brine, was left motionless for several hours. The insoluble impurities of the brine sedimented according to their specific weight: the lightest of them floated to the top, while the heaviest (metals and minerals) settled on the bottom. Above the sediment lying on the bottom of the trough and under that at the top remained a rather thick layer of fairly clean brine. During the experiments, the lower sediment has never reached 3 cm in thickness. The wider tops of the plugs that were inserted into the holes found at the bottom of the trough, were at least 3 cm high. Because of this, the upper edges of the plugs remained above the sediment on the bottom of the trough. We then slightly raised the long sticks that were tightly inserted into the axial holes of the plugs, which in turn tightly closed the holes in the trough’s bottom. The sticks were fixed and maintained in a slightly raised position by a kind of pliers – half split twigs – set transversely over the trough opening. In this way, the brine was allowed to drain easily into channelled pieces set under the trough. The brine then flowed through the channelled pieces to the next trough(s). The process could be repeated in the next trough(s) until the salt makers would get a fairly clean and highly concentrated brine. Ethnographic survey. Băile Figa and its surroundings are places where the evidence for ethnographic research, of what is commonly called ‘the traditional salt civilization’, can still be found. In every ancient salt production archaeological site known in Romania, without any exception, the current folk salt exploitation is still in progress. The latter offers to these sites a valuable research potential, almost unique in Europe, for the ethnoarchaeological research. The ethnographic survey has attested a number of aspects of the present-day folk ways of exploiting brine, rock salt, salt mud, and halophytic vegetation, as well as other traditional practices and customs related to these resources. Brine folk exploitation. The most exploited saline occurrence at Băile Figa is currently brine. Brine is taken directly from the numerous springs filling the central salty stream valley (Fig. 48/1). Then, it is loaded into plastic drums of 50 to 200 litres and transported by carts to the neighbouring villages (Fig. 48/2). The locals told us that, in the past, the brine was transported in large, cone-shaped barrels, called “bote mari”, of 60 litres, made of softwood boards connected to each other with circles of hazel twigs (Fig. 49/5), in smaller containers, of approx. 20 litres, called “barbânțe” (Fig. 49/3), as well as in smaller containers hollowed out of tree trunks and called “bote” (Fig. 49/2). The most remote localities, to which the brine from Băile Figa is transported, are situated at a distance of 11 km. But most people that currently get brine from Băile Figa live within a maximum perimeter of 6 km. Brine is mainly used for preserving meat, bacon (especially around the winter holidays), and vegetables. Sometimes the brine is used for health care purposes, mainly against colds, rheumatic pains, skin diseases or circulatory deficiencies, either on the spot or at home. In the 1960s and 1970s, the locals built two brine ponds and used them for health cure baths. Rock salt folk exploitation. According to some elderly locals, until 1989, the rock salt was periodically extracted at Băile Figa, by manual or mechanized digging of vertical pits. It was mainly used to supplement the feed of domestic animals in the individual households, sheepfolds (Fig. 50) and collective farms or state agricultural enterprises. Sometimes, the locals crushed and grinded salt lumps. In some households in the village of Figa, we have identified and documented some primitive millstones used in salt grinding (Fig. 49/1). Ground salt is added to animal feed and very rarely in human food, people being sure that this kind of salt can harm their health. Sapropelic mud folk exploitation. The ethnographic surveys have documented the traditional exploitation of sapropelic mud at Băile Figa. It is found only in some limited spots of the salt stream valley. The spots with small deposits of sapropelic mud are known only by “connoisseurs” who, among the clues, are guided by a specific smell. The sapropelic mud is used for health care purposes, especially for the treatment of rheumatic diseases. The mud is applied, either on most of the body or only on the parts affected by pain. Sometimes, the mud is applied to animal wounds, for disinfection and drying. Mud-based treatments are done both on-site and at home. Shepherding. Until the building, during 2007 – 2011, of the leisure resort, Băile Figa was the favourite place for grazing for the local domestic animals (sheep, cows, buffaloes, and horses). The animals, according to the information delivered by the shepherds, loved salt grass and brine (Fig. 49/2). Shepherds tried to prevent the animals from drinking brine from the springs because their fondness of the salty taste made them to drink it in unhealthy quantities, so that they could “swell” and die. Beekeeping. In the northern sector of the salt stream valley, at the surface of the soil, in the summer of 2018, a primitive beehive made of a hollowed-out oak trunk was discovered (Fig. 48/4). So far, as we can know, it is a unique find of this sort in a saline context.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

IntroductionThe common origin of the adjective “corporeal” and the noun “corpse” in the Latin root corpus points to the value of mortuary practices for investigating how the human body is objectified. In post-mortem rituals, the body—formerly the manipulator of objects—becomes itself the object that is manipulated. Thus, these funerary rituals provide a type of double reflexivity, where the object and subject of manipulation can be used to reciprocally illuminate one another. To this extent, any consideration of corporeality can only benefit from a discussion of how the body is objectified through mortuary practices. This paper offers just such a discussion with respect to a selection of two contrasting mortuary practices, in the context of the prehistoric past and the Classical Era respectively. At the most general level, we are motivated by the same intellectual impulse that has stimulated expositions on corporeality, materiality, and incarnation in areas like phenomenology (Merleau-Ponty 77–234), Marxism (Adorno 112–119), gender studies (Grosz vii–xvi), history (Laqueur 193–244), and theology (Henry 33–53). That is to say, our goal is to show that the body, far from being a transparent frame through which we encounter the world, is in fact a locus where historical, social, cultural, and psychological forces intersect. On this view, “the body vanishes as a biological entity and becomes an infinitely malleable and highly unstable culturally constructed product” (Shilling 78). However, for all that the cited paradigms offer culturally situated appreciations of corporeality; our particular intellectual framework will be provided by cognitive science. Two reasons impel us towards this methodological choice.In the first instance, the study of ritual has, after several decades of stagnation, been rewarded—even revolutionised—by the application of insights from the new sciences of the mind (Whitehouse 1–12; McCauley and Lawson 1–37). Thus, there are good reasons to think that ritual treatments of the body will refract historical and social forces through empirically attested tendencies in human cognition. In the present connection, this means that knowledge of these tendencies will reward any attempt to theorise the objectification of the body in mortuary rituals.In the second instance, because beliefs concerning the afterlife can never be definitively judged to be true or false, they give free expression to tendencies in cognition that are otherwise constrained by the need to reflect external realities accurately. To this extent, they grant direct access to the intuitive ideas and biases that shape how we think about the world. Already, this idea has been exploited to good effect in areas like the cognitive anthropology of religion, which explores how counterfactual beings like ghosts, spirits, and gods conform to (and deviate from) pre-reflective cognitive patterns (Atran 83–112; Barrett and Keil 219–224; Barrett and Reed 252–255; Boyer 876–886). Necessarily, this implies that targeting post-mortem treatments of the body will offer unmediated access to some of the conceptual schemes that inform thinking about human corporeality.At a more detailed level, the specific methodology we propose to use will be provided by conceptual blending theory—a framework developed by Gilles Fauconnier, Mark Turner, and others to describe how structures from different areas of experience are creatively blended to form a new conceptual frame. In this system, a generic space provides the ground for coordinating two or more input spaces into a blended space that synthesises them into a single output. Here this would entail using natural or technological processes to structure mortuary practices in a way that satisfies various psychological needs.Take, for instance, W.B. Yeats’s famous claim that “Too long a sacrifice / Can make a stone of the heart” (“Easter 1916” in Yeats 57-8). Here, the poet exploits a generic space—that of everyday objects and the effort involved in manipulating them—to coordinate an organic input from that taxonomy (the heart) with an inorganic input (a stone) to create the blended idea that too energetic a pursuit of an abstract ideal turns a person into an unfeeling object (the heart-as-stone). Although this particular example corresponds to a familiar rhetorical figure (the metaphor), the value of conceptual blending theory is that it cuts across distinctions of genre, media, language, and discourse level to provide a versatile framework for expressing how one area of human experience is related to another.As indicated, we will exploit this versatility to investigate two ways of objectifying the body through the examination of two contrasting mortuary practices—cremation and inhumation—against different cultural horizons. The first of these is the conceptualisation of the body as an object of a technical process, where the post-mortem cremation of the corpse is analogically correlated with the metallurgical refining of ore into base metal. Our area of focus here will be Bronze Age cremation practices. The second conceptual scheme we will investigate focuses on treatments of the body as a vegetable object; here, the relevant analogy likens the inhumation of the corpse to the planting of a seed in the soil from which future growth will come. This discussion will centre on the Classical Era. Burning: The Body as Manufactured ObjectThe Early and Middle Bronze Age in Western Europe (2500-1200 BCE) represented a period of change in funerary practices relative to the preceding Neolithic, exemplified by a move away from the use of Megalithic monuments, a proliferation of grave goods, and an increase in the use of cremation (Barrett 38-9; Cooney and Grogan 105-121; Brück, Material Metaphors 308; Waddell, Bronze Age 141-149). Moreover, the Western European Bronze Age is characterised by a shift away from communal burial towards single interment (Barrett 32; Bradley 158-168). Equally, the Bronze Age in Western Europe provides us with evidence of an increased use of cist and pit cremation burials concentrated in low-lying areas (Woodman 254; Waddell, Prehistoric 16; Cooney and Grogan 105-121; Bettencourt 103). This greater preference for lower-lying location appears to reflect a distinctive change in comparison to the distribution patterns of the Neolithic burials; these are often located on prominent, visible aspects of a landscape (Cooney and Grogan 53-61). These new Bronze Age burial practices appear to reflect a distancing in relation to the territories of the “old ancestors” typified by Megalithic monuments (Bettencourt 101-103). Crucially, the Bronze Age archaeological record provides us with evidence that indicates that cremation was becoming the dominant form of deposition of human remains throughout Central and Western Europe (Sørensen and Rebay 59-60).The activities associated with Bronze Age cremations such as the burning of the body and the fragmentation of the remains have often been considered as corporeal equivalents (or expressions) of the activities involved in metal (bronze) production (Brück, Death 84-86; Sørensen and Rebay 60–1; Rebay-Salisbury, Cremations 66-67). There are unequivocal similarities between the practices of cremation and contemporary bronze production technologies—particularly as both processes involve the transformation of material through the application of fire at temperatures between 700 ºC to 1000 ºC (Musgrove 272-276; Walker et al. 132; de Becdelievre et al. 222-223).We assert that the technologies that define the European Bronze Age—those involved in alloying copper and tin to produce bronze—offered a new conceptual frame that enabled the body to be objectified in new ways. The fundamental idea explored here is that the displacement of inhumation by cremation in the European Bronze Age was motivated by a cognitive shift, where new smelting technologies provided novel conceptual metaphors for thinking about age-old problems concerning human mortality and post-mortem survival. The increased use of cremation in the European Bronze Age contrasts with the archaeological record of the Near Eastern—where, despite the earlier emergence of metallurgy (3300–3000 BCE), we do not see a notable proliferation in the use of cremation in this region. Thus, mortuary practices (i.e. cremation) provide us with an insight into how Western European Bronze Age cultures mediated the body through changes in technological objects and processes.In the terminology of conceptual blending, the generic space in question centres on the technical manipulation of the material world. The first input space is associated with the anxiety attending mortality—specifically, the cessation of personal identity and the extinction of interpersonal relationships. The second input space represents the technical knowledge associated with bronze production; in particular, the extraction of ore from source material and its mixing with other metals to form an alloy. The blended space coordinates these inputs to objectify the human body as an object that is ritually transformed into a new but more durable substance via the cremation process. In this contention we use the archaeological record to draw a conceptual parallel between the emergence of bronze production technology—centring on transition of naturally occurring material to a new subsistence (bronze)—and the transitional nature of the cremation process.In this theoretical framework, treating the body as a mixture of substances that can be reduced to its constituents and transformed through technologies of cremation enabled Western European Bronze Age society to intervene in the natural process of putrefaction and transform the organic matter into something more permanent. This transformative aspect of the cremation is seen in the evidence we have for secondary burial practices involving the curation and circulation of cremated bones of deceased members of a group (Brück, Death 87-93). This evidence allows us to assert that cremated human remains and objects were considered products of the same transformation into a more permanent state via burning, fragmentation, dispersal, and curation. Sofaer (62-69) states that the living body is regarded as a person, but as soon as the transition to death is made, the body becomes an object; this is an “ontological shift in the perception of the body that assumes a sudden change in its qualities” (62).Moreover, some authors have proposed that the exchange of fragmented human remains was central to mortuary practices and was central in establishing and maintaining social relations (Brück, Death 76-88). It is suggested that in the Early Bronze Age the perceptions of the human body mirrored the perceptions of objects associated with the arrival of the new bronze technology (Brück, Death 88-92). This idea is more pronounced if we consider the emergence of bronze technology as the beginning of a period of capital intensification of natural resources. Through this connection, the Bronze Age can be regarded as the point at which a particular natural resource—in this case, copper—went through myriad intensive manufacturing stages, which are still present today (intensive extraction, production/manufacturing, and distribution). Unlike stone tool production, bronze production had the addition of fire as the explicit method of transformation (Brück, Death 88-92). Thus, such views maintain that the transition achieved by cremation—i.e. reducing the human remains to objects or tokens that could be exchanged and curated relatively soon after the death of the individual—is equivalent to the framework of commodification connected with bronze production.A sample of cremated remains from Castlehyde in County Cork, Ireland, provides us with an example of a Bronze Age cremation burial in a Western European context (McCarthy). This is chosen because it is a typical example of a Bronze Age cremation burial in the context of Western Europe; also, one of the authors (MG) has first-hand experience in the analysis of its associated remains. The Castlehyde cremation burial consisted of a rectangular, stone-lined cist (McCarthy). The cist contained cremated, calcined human remains, with the fragments generally ranging from a greyish white to white in colour; this indicates that the bones were subject to a temperature range of 700-900ºC. The organic content of bone was destroyed during the cremation process, leaving only the inorganic matrix (brittle bone which is, often, described as metallic in consistency—e.g. Gejvall 470-475). There is evidence that remains may have been circulated in a manner akin to valuable metal objects. First of all, the absence of long bones indicates that there may have been a practice of removing salient remains as curatable records of ancestral ties. Secondly, remains show traces of metal staining from objects that are no longer extant, which suggests that graves were subject to secondary burial practices involving the removal of metal objects and/or human bone. To this extent, we can discern that human remains were being processed, curated, and circulated in a similar manner to metal objects.Thus, there are remarkable similarities between the treatment of the human body in cremation and bronze metal production technologies in the European Bronze Age. On the one hand, the parallel between smelting and cremation allowed death to be understood as a process of transformation in which the individual was removed from processes of organic decay. On the other hand, the circulation of the transformed remains conferred a type of post-mortem survival on the deceased. In this way, cremation practices may have enabled Bronze Age society to symbolically overcome the existential anxiety concerning the loss of personhood and the breaking of human relationships through death. In relation to the former point, the resurgence of cremation in nineteenth century Europe provides us with an example of how the disposal of a human body can be contextualised in relation to socio-technological advancements. The (re)emergence of cremation in this period reflects the post-Enlightenment shift from an understanding of the world through religious beliefs to the use of rational, scientific approaches to examine the natural world, including the human body (and death). The controlled use of fire in the cremation process, as well as the architecture of crematories, reflected the industrial context of the period (Rebay-Salisbury, Inhumation 16).With respect to the circulation of cremated remains, Smith suggests that Early Medieval Christian relics of individual bones or bone fragments reflect a reconceptualised continuation of pre-Christian practices (beginning in Christian areas of the Roman Empire). In this context, it is claimed, firstly, that the curation of bone relics and the use of mobile bone relics of important, saintly individuals provided an embodied connection between the sacred sphere and the earthly world; and secondly, that the use of individual bones or fragments of bone made the Christian message something portable, which could be used to reinforce individual or collective adherence to Christianity (Smith 143-167). Using the example of the Christian bone relics, we can thus propose that the curation and circulation of Bronze Age cremated material may have served a role similar to tools for focusing religiously oriented cognition. Burying: The Body as a Vegetable ObjectGiven that the designation “the Classical Era” nominates the entirety of the Graeco-Roman world (including the Near East and North Africa) from about 800 BCE to 600 CE, there were obviously no mortuary practices common to all cultures. Nevertheless, in both classical Greece and Rome, we have examples of periods when either cremation or inhumation was the principal funerary custom (Rebay-Salisbury, Inhumation 19-21).For instance, the ancient Homeric texts inform us that the ancient Greeks believed that “the spirit of the departed was sentient and still in the world of the living as long as the flesh was in existence […] and would rather have the body devoured by purifying fire than by dogs or worms” (Mylonas 484). However, the primary sources and archaeological record indicate that cremation practices declined in Athens circa 400 BCE (Rebay-Salisbury, Inhumation 20). With respect to the Roman Empire, scholarly opinion argues that inhumation was the dominant funerary rite in the eastern part of the Empire (Rebay-Salisbury, Inhumation 17-21; Morris 52). Complementing this, the archaeological and historical record indicates that inhumation became the primary rite throughout the Roman Empire in the first century CE. Inhumation was considered to be an essential rite in the context of an emerging belief that a peaceful afterlife was reflected by a peaceful burial in which bodily integrity was maintained (Rebay-Salisbury, Inhumation 19-21; Morris 52; Toynbee 41). The question that this poses is how these beliefs were framed in the broader discourses of Classical culture.In this regard, our claim is that the growth in inhumation was driven (at least in part) by the spread of a conceptual scheme, implicit in Greek fertility myths that objectify the body as a seed. The conceptual logic here is that the post-mortem continuation of personal identity is (symbolically) achieved by objectifying the body as a vegetable object that will re-grow from its own physical remains. Although the dominant metaphor here is vegetable, there is no doubt that the motivating concern of this mythological fabulation is human mortality. As Jon Davies notes, “the myths of Hades, Persephone and Demeter, of Orpheus and Eurydice, of Adonis and Aphrodite, of Selene and Endymion, of Herakles and Dionysus, are myths of death and rebirth, of journeys into and out of the underworld, of transactions and transformations between gods and humans” (128). Thus, such myths reveal important patterns in how the post-mortem fate of the body was conceptualised.In the terminology of mental mapping, the generic space relevant to inhumation contains knowledge pertaining to folk biology—specifically, pre-theoretical ideas concerning regeneration, survival, and mortality. The first input space attaches to human mortality; it departs from the anxiety associated with the seeming cessation of personal identity and dissolution of kin relationships subsequent to death. The second input space is the subset of knowledge concerning vegetable life, and how the immersion of seeds in the soil produces a new generation of plants with the passage of time. The blended space combines the two input spaces by way of the funerary script, which involves depositing the body in the soil with a view to securing its eventual rebirth by analogy with the sprouting of a planted seed.As indicated, the most important illustration of this conceptual pattern can be found in the fertility myths of ancient Greece. The Homeric Hymns, in particular, provide a number of narratives that trace out correspondences between vegetation cycles, human mortality, and inhumation, which inform ritual practice (Frazer 223–404; Carney 355–65; Sowa 121–44). The Homeric Hymn to Demeter, for instance, charts how Persephone is abducted by Hades, god of the dead, and taken to his underground kingdom. While searching for her missing daughter, Demeter, goddess of fertility, neglects the earth, causing widespread devastation. Matters are resolved when Zeus intervenes to restore Persephone to Demeter. However, having ingested part of Hades’s kingdom (a pomegranate seed), Persephone is obliged to spend half the year below ground with her captor and the other half above ground with her mother.The objectification of Persephone as both a seed and a corpse in this narrative is clearly signalled by her seasonal inhumation in Hades’ chthonic realm, which is at once both the soil and the grave. And, just as the planting of seeds in autumn ensures rebirth in spring, Persephone’s seasonal passage from the Kingdom of the Dead nominates the individual human life as just one season in an endless cycle of death and rebirth. A further signifying element is added by the ingestion of the pomegranate seed. This is evocative of her being inseminated by Hades; thus, the coordination of vegetation cycles with life and death is correlated with secondary transition—that from childhood to adulthood (Kerényi 119–183).In the examples given, we can see how the Homeric Hymn objectifies both the mortal and sexual destiny of the body in terms of thresholds derived from the vegetable world. Moreover, this mapping is not merely an intellectual exercise. Its emotional and social appeal is visible in the fact that the Eleusinian mysteries—which offered the ritual hom*ologue to the Homeric Hymn to Demeter—persisted from the Mycenaean period to 396 CE, one of the longest recorded durations for any ritual (Ferguson 254–9; Cosmopoulos 1–24). In sum, then, classical myth provided a precedent for treating the body as a vegetable object—most often, a seed—that would, in turn, have driven the move towards inhumation as an important mortuary practice. The result is to create a ritual form that makes key aspects of human experience intelligible by connecting them with cyclical processes like the seasons of the year, the harvesting of crops, and the intergenerational oscillation between the roles of parent and child. Indeed, this pattern remains visible in the germination metaphors and burial practices of contemporary religions such as Christianity, which draw heavily on the symbolism associated with mystery cults like that at Eleusis (Nock 177–213).ConclusionWe acknowledge that our examples offer a limited reflection of the ethnographic and archaeological data, and that they need to be expanded to a much greater degree if they are to be more than merely suggestive. Nevertheless, suggestiveness has its value, too, and we submit that the speculations explored here may well offer a useful starting point for a larger survey. In particular, they showcase how a recurring existential anxiety concerning death—involving the fear of loss of personal identity and kinship relations—is addressed by different ways of objectifying the body. Given that the body is not reducible to the objects with which it is identified, these objectifications can never be entirely successful in negotiating the boundary between life and death. In the words of Jon Davies, “there is simply no let-up in the efforts by human beings to transcend this boundary, no matter how poignantly each failure seemed to reinforce it” (128). For this reason, we can expect that the record will be replete with conceptual and cognitive schemes that mediate the experience of death.At a more general level, it should also be clear that our understanding of human corporeality is rewarded by the study of mortuary practices. No less than having a body is coextensive with being human, so too is dying, with the consequence that investigating the intersection of both areas is likely to reveal insights into issues of universal cultural concern. For this reason, we advocate the study of mortuary practices as an evolving record of how various cultures understand human corporeality by way of external objects.ReferencesAdorno, Theodor W. Metaphysics: Concept and Problems. Trans. Rolf Tiedemann. Stanford: Stanford UP, 2002.Atran, Scott. In Gods We Trust: The Evolutionary Landscape of Religion. Oxford: Oxford UP, 2002.Barrett, John C. “The Living, the Dead and the Ancestors: Neolithic and Bronze Age Mortuary Practices.” The Archaeology of Context in the Neolithic and Bronze Age: Recent Trends. Eds. John. C. Barrett and Ian. A. Kinnes. University of Sheffield: Department of Archaeology and Prehistory, 1988. 30-41.Barrett, Justin, and Frank Keil. “Conceptualizing a Nonnatural Entity: Anthropomorphism in God Concepts.” Cognitive Psychology 31.3 (1996): 219–47.Barrett, Justin, and Emily Reed. “The Cognitive Science of Religion.” The Psychologist 24.4 (2011): 252–255.Bettencourt, Ana. “Life and Death in the Bronze Age of the NW of the Iberian Peninsula.” The Materiality of Death: Bodies, Burials, Beliefs. Eds. Fredrik Fahlanderand and Terje Osstedaard. Oxford: Archaeopress, 2008. 99-105.Boyer, Pascal. “Cognitive Tracks of Cultural Inheritance: How Evolved Intuitive Ontology Governs Cultural Transmission.” American Anthropologist 100.4 (1999): 876–889.Bradley, Richard. The Prehistory of Britain and Ireland. Cambridge: Cambridge UP, 2007.Brück, Joanna. “Material Metaphors: The Relational Construction of Identity in Bronze Age Burials in Ireland and Britain” Journal of Social Archaeology 4(3) (2004): 307-333.———. “Death, Exchange and Reproduction in the British Bronze Age.” European Journal of Archaeology 9.1 (2006): 73–101.Carney, James. “Narrative and Ontology in Hesiod’s Homeric Hymn to Demeter: A Catastrophist Approach.” Semiotica 167.1 (2007): 337–368.Cooney, Gabriel, and Eoin Grogan. Irish Prehistory: A Social Perspective. Dublin: Wordwell, 1999.Cosmopoulos, Michael B. “Mycenean Religion at Eleusis: The Architecture and Stratigraphy of Megaron B.” Greek Mysteries: The Archaeology and Ritual of Ancient Greek Secret Cults. Ed. Michael B. Cosmopoulos. London: Routledge, 2003. 1–24.Davies, Jon. Death, Burial, and Rebirth in the Religions of Antiquity. London: Psychology Press, 1999.De Becdelievre, Camille, Sandrine Thiol, and Frédéric Santos. “From Fire-Induced Alterations on Human Bones to the Original Circ*mstances of the Fire: An Integrated Approach of Human Remains Drawn from a Neolithic Collective Burial”. Journal of Archaeological Science: Reports 4 (2015) 210–225.Fauconnier, Gilles, and Mark Turner. The Way We Think: Conceptual Blending and the Mind’s Hidden Complexities. New York: Basic Books, 2002.Ferguson, Everett. Backgrounds of Early Christianity. Grand Rapids, MI: Wm. B. Eerdmans Publishing, 2003.Frazer, James. The Golden Bough: A Study in Magic and Religion. Oxford: Oxford UP, 1998.Gejvall, Nils. "Cremations." Science and Archaeology: A Survey of Progress and Research. Eds. Don Brothwell and Eric Higgs. London: Thames and Hudson, 1969. 468-479.Grosz, Elizabeth. Volatile Bodies: Toward a Corporeal Feminism. Bloomington: Indiana UP, 1994.Henry, Michel. I Am the Truth: Toward a Philosophy of Christianity. Trans. Susan Emanuel. Stanford: Stanford UP, 2003.Kerényi, Karl. “Kore.” The Science of Mythology. Trans. Richard F.C. Hull. London: Routledge, 1985. 119–183.Laqueur, Thomas. Making Sex: Body and Gender from the Greeks to Freud. Cambridge MA: Harvard UP, 1990.McCarthy, Margaret. “2003:0195 - Castlehyde, Co. Cork.” Excavations.ie. The Department of Arts, Heritage and the Gaeltacht, 4 July 2003. 12 Jan. 2016 <http://www.excavations.ie/report/2003/Cork/0009503/>.McCauley, Robert N., and E. Thomas Lawson. Bringing Ritual to Mind: Psychological Foundations of Cultural Forms. Cambridge: Cambridge UP, 2002.Merleau-Ponty, Maurice. Phenomenology of Perception. Trans: Colin Smith. London: Routledge, 2002.Morris, Ian. Death Ritual and Social Structure in Classical Antiquity. Cambridge: Cambridge UP, 1992.Musgrove, Jonathan. “Dust and Damn'd Oblivion: A Study of Cremation in Ancient Greece.” The Annual of the British School at Athens 85 (1990), 271-299.Mylonas, George. “Burial Customs.” A Companion to Homer. Eds. Alan Wace and Frank. H. Stubbings. London: Macmillan, 1962. 478-488.Nock, Arthur. D. “Hellenistic Mysteries and Christian Sacraments.” Mnemosyne 1 (1952): 177–213.Rebay-Salisbury, Katherina. "Cremations: Fragmented Bodies in the Bronze and Iron Ages." Body Parts and Bodies Whole: Changing Relations and Meanings. Eds. Katherina Rebay-Salisbury, Marie. L. S. Sørensen, and Jessica Hughes. Oxford: Oxbow, 2010. 64-71.———. “Inhumation and Cremation: How Burial Practices Are Linked to Beliefs.” Embodied Knowledge: Historical Perspectives on Technology and Belief. Eds Marie. L.S. Sørensen and Katherina Rebay-Salisbury. Oxford: Oxbow, 2012. 15-26.Shilling, Chris. The Body and Social Theory. Nottingham: SAGE, 2012.Smith, Julia M.H. “Portable Christianity: Relics in the Medieval West (c.700–1200).” Proceedings of the British Academy 181 (2012): 143–167.Sofaer, Joanna R. The Body as Material Culture: A Theoretical Osteoarchaeology. Cambridge: Cambridge UP, 2006.Sørensen, Marie L.S., and Katharina Rebay-Salisbury. “From Substantial Bodies to the Substance of Bodies: Analysis of the Transition from Inhumation to Cremation during the Middle Bronze Age in Europe.” Past Bodies: Body-Centered Research in Archaeology. Eds. Dušan Broić and John Robb. Oxford: Oxbow Books, 2008. 59–68.Sowa, Cora Angier. Traditional Themes and the Homeric Hymns. Wauconda, IL: Bolchazy-Carducci Publishers, 1984.Toynbee, Jocelyn M.C. Death and Burial in the Roman World. London: Thames and Hudson, 1971.Waddell, John. The Bronze Age Burials of Ireland. Galway: Galway UP, 1990.———. The Prehistoric Archaeology of Ireland. Galway: Galway UP, 2005.Walker, Philip L., Kevin W.P. Miller, and Rebecca Richman. “Time, Temperature, and Oxygen Availability: An Experimental Study of the Effects of Environmental Conditions on the Colour and Organic Content of Cremated Bone.” The Analysis of Burned Human Remains. Eds. Christopher W. Schmidt and Steven A. Symes. London: Academic Press, 2008. 129–135.Whitehouse, Harvey. Arguments and Icons: Divergent Modes of Religiosity. Oxford: Oxford UP, 2000.Woodman Peter. “Prehistoric Settlements and Environment.” The Quaternary History of Ireland. Eds. Kevin J. Edwards and William P. Warren. London: Academic Press, 1985. 251-278.Yeats, William Butler. “Easter 1916.” W.B. Yeats: The Major Works. Ed. Edward Larrissey. Oxford: Oxford UP, 1997. 85–87.

APA, Harvard, Vancouver, ISO, and other styles